ID: 1160694394

View in Genome Browser
Species Human (GRCh38)
Location 19:475547-475569
Sequence AGGCAGCCGTGCAGAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160694391_1160694394 -7 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data
1160694387_1160694394 19 Left 1160694387 19:475505-475527 CCACGGAGAAGGTAAAACTGAAC No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data
1160694386_1160694394 20 Left 1160694386 19:475504-475526 CCCACGGAGAAGGTAAAACTGAA No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data
1160694385_1160694394 21 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data
1160694392_1160694394 -8 Left 1160694392 19:475532-475554 CCAAAGCAGGTGAGGAGGCAGCC No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160694394 Original CRISPR AGGCAGCCGTGCAGAGGCCC TGG Intergenic