ID: 1160694397

View in Genome Browser
Species Human (GRCh38)
Location 19:475553-475575
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160694397_1160694402 -9 Left 1160694397 19:475553-475575 CCGTGCAGAGGCCCTGGGGCAGC No data
Right 1160694402 19:475567-475589 TGGGGCAGCGGCGAGGACAGCGG No data
1160694397_1160694405 -4 Left 1160694397 19:475553-475575 CCGTGCAGAGGCCCTGGGGCAGC No data
Right 1160694405 19:475572-475594 CAGCGGCGAGGACAGCGGGGAGG No data
1160694397_1160694403 -8 Left 1160694397 19:475553-475575 CCGTGCAGAGGCCCTGGGGCAGC No data
Right 1160694403 19:475568-475590 GGGGCAGCGGCGAGGACAGCGGG No data
1160694397_1160694404 -7 Left 1160694397 19:475553-475575 CCGTGCAGAGGCCCTGGGGCAGC No data
Right 1160694404 19:475569-475591 GGGCAGCGGCGAGGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160694397 Original CRISPR GCTGCCCCAGGGCCTCTGCA CGG (reversed) Intergenic