ID: 1160694399 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:475560-475582 |
Sequence | GAGGCCCTGGGGCAGCGGCG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160694392_1160694399 | 5 | Left | 1160694392 | 19:475532-475554 | CCAAAGCAGGTGAGGAGGCAGCC | No data | ||
Right | 1160694399 | 19:475560-475582 | GAGGCCCTGGGGCAGCGGCGAGG | No data | ||||
1160694391_1160694399 | 6 | Left | 1160694391 | 19:475531-475553 | CCCAAAGCAGGTGAGGAGGCAGC | No data | ||
Right | 1160694399 | 19:475560-475582 | GAGGCCCTGGGGCAGCGGCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160694399 | Original CRISPR | GAGGCCCTGGGGCAGCGGCG AGG | Intergenic | ||