ID: 1160694403

View in Genome Browser
Species Human (GRCh38)
Location 19:475568-475590
Sequence GGGGCAGCGGCGAGGACAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160694397_1160694403 -8 Left 1160694397 19:475553-475575 CCGTGCAGAGGCCCTGGGGCAGC No data
Right 1160694403 19:475568-475590 GGGGCAGCGGCGAGGACAGCGGG No data
1160694391_1160694403 14 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694403 19:475568-475590 GGGGCAGCGGCGAGGACAGCGGG No data
1160694392_1160694403 13 Left 1160694392 19:475532-475554 CCAAAGCAGGTGAGGAGGCAGCC No data
Right 1160694403 19:475568-475590 GGGGCAGCGGCGAGGACAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160694403 Original CRISPR GGGGCAGCGGCGAGGACAGC GGG Intergenic
No off target data available for this crispr