ID: 1160694405

View in Genome Browser
Species Human (GRCh38)
Location 19:475572-475594
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160694392_1160694405 17 Left 1160694392 19:475532-475554 CCAAAGCAGGTGAGGAGGCAGCC No data
Right 1160694405 19:475572-475594 CAGCGGCGAGGACAGCGGGGAGG No data
1160694391_1160694405 18 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694405 19:475572-475594 CAGCGGCGAGGACAGCGGGGAGG No data
1160694397_1160694405 -4 Left 1160694397 19:475553-475575 CCGTGCAGAGGCCCTGGGGCAGC No data
Right 1160694405 19:475572-475594 CAGCGGCGAGGACAGCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160694405 Original CRISPR CAGCGGCGAGGACAGCGGGG AGG Intergenic