ID: 1160696693

View in Genome Browser
Species Human (GRCh38)
Location 19:488574-488596
Sequence CGCTGCTGGGACTGACGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160696687_1160696693 -10 Left 1160696687 19:488561-488583 CCCTCGTCCCTCGCGCTGCTGGG No data
Right 1160696693 19:488574-488596 CGCTGCTGGGACTGACGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160696693 Original CRISPR CGCTGCTGGGACTGACGTCC GGG Intergenic
No off target data available for this crispr