ID: 1160697444

View in Genome Browser
Species Human (GRCh38)
Location 19:491810-491832
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 3, 1: 6, 2: 10, 3: 41, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160697444_1160697462 29 Left 1160697444 19:491810-491832 CCTGGGCGGAGACAGCCCCAGGC 0: 3
1: 6
2: 10
3: 41
4: 275
Right 1160697462 19:491862-491884 CAAGCCCCCCCTCCCCTGGGAGG 0: 5
1: 3
2: 8
3: 48
4: 385
1160697444_1160697459 26 Left 1160697444 19:491810-491832 CCTGGGCGGAGACAGCCCCAGGC 0: 3
1: 6
2: 10
3: 41
4: 275
Right 1160697459 19:491859-491881 CCCCAAGCCCCCCCTCCCCTGGG 0: 5
1: 0
2: 4
3: 68
4: 664
1160697444_1160697447 -7 Left 1160697444 19:491810-491832 CCTGGGCGGAGACAGCCCCAGGC 0: 3
1: 6
2: 10
3: 41
4: 275
Right 1160697447 19:491826-491848 CCCAGGCACCGCCTCTCCCCTGG 0: 4
1: 3
2: 7
3: 55
4: 502
1160697444_1160697450 -3 Left 1160697444 19:491810-491832 CCTGGGCGGAGACAGCCCCAGGC 0: 3
1: 6
2: 10
3: 41
4: 275
Right 1160697450 19:491830-491852 GGCACCGCCTCTCCCCTGGGCGG 0: 4
1: 3
2: 5
3: 21
4: 231
1160697444_1160697449 -6 Left 1160697444 19:491810-491832 CCTGGGCGGAGACAGCCCCAGGC 0: 3
1: 6
2: 10
3: 41
4: 275
Right 1160697449 19:491827-491849 CCAGGCACCGCCTCTCCCCTGGG 0: 4
1: 3
2: 9
3: 35
4: 348
1160697444_1160697457 25 Left 1160697444 19:491810-491832 CCTGGGCGGAGACAGCCCCAGGC 0: 3
1: 6
2: 10
3: 41
4: 275
Right 1160697457 19:491858-491880 GCCCCAAGCCCCCCCTCCCCTGG 0: 5
1: 0
2: 5
3: 116
4: 844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160697444 Original CRISPR GCCTGGGGCTGTCTCCGCCC AGG (reversed) Intronic
900121181 1:1049304-1049326 GCCTGGAGCTGTCCCGGCACTGG + Exonic
900192804 1:1358611-1358633 GCCTGGGCCTGTCTACGGTCTGG + Intronic
900496712 1:2979056-2979078 GTAGGGGGCTGTCTCCACCCAGG + Intergenic
900593196 1:3468858-3468880 TCCTGGGCCTGTGTCCCCCCAGG + Exonic
900779958 1:4611665-4611687 GTGTGGGGCTGCCTCAGCCCCGG - Intergenic
900896485 1:5486434-5486456 GCCTGGGGCTGTCTGCCTCCAGG + Intergenic
901040460 1:6360183-6360205 GGCTGGTGCTGCCCCCGCCCAGG + Intronic
901640914 1:10692573-10692595 GCCTGGGGACCTCTGCGCCCGGG - Intronic
901768471 1:11518580-11518602 GCCTGGGGCTGTCTCCCCAGTGG + Intronic
901869067 1:12126911-12126933 GCCTGGGGCTTTTTCCTTCCTGG + Intronic
902166047 1:14572413-14572435 GCCTGGGGCTATTTTCACCCAGG - Intergenic
902707094 1:18213034-18213056 GCCCGGGGCTTTCTCTTCCCTGG + Intronic
902737229 1:18409157-18409179 TCCCGGGGCTGTGTCAGCCCTGG - Intergenic
902810688 1:18886214-18886236 GTCTGGGAATGTCTCAGCCCTGG + Intronic
905435227 1:37951167-37951189 GGGTGGGGCTGTCTCACCCCAGG + Intergenic
906200079 1:43954299-43954321 CCCTGGGGCTGTCTCTGGGCTGG + Intronic
908513385 1:64868313-64868335 GCCAGGTGCTGTCTCAGTCCTGG - Intronic
913995683 1:143650532-143650554 GCGTGAGACTGTCTCCGCCGAGG - Intergenic
914431624 1:147624450-147624472 CCCTGGGGCTGTTTACGGCCTGG - Exonic
915001680 1:152600130-152600152 GTCTGGTGCTGTCACCTCCCTGG + Intronic
915510044 1:156381904-156381926 GGCTGGGACTGTCTCCACGCTGG + Exonic
916335336 1:163664802-163664824 GCCTGGGGCTGCCCCAGCTCTGG + Intergenic
917442916 1:175082737-175082759 CCCTGGAGGTGTCTCCACCCAGG - Intronic
922725862 1:227922730-227922752 GGCTGGGCCTGTCCCCTCCCAGG + Intronic
1063387119 10:5623055-5623077 GCCTGGGGGTGTCACACCCCGGG - Intergenic
1063982394 10:11464691-11464713 GCCTGTGGCTGTCTCAGGCCAGG - Intronic
1066362004 10:34740216-34740238 GGCTGGGGCTGTCTCCCAGCCGG - Intronic
1067031514 10:42880921-42880943 CCCTTGGGCTGGCTCAGCCCAGG - Intergenic
1067535006 10:47102656-47102678 GCCTGAGACTCTCTCTGCCCTGG + Intergenic
1068025606 10:51639406-51639428 GTCTGGCTCTGTCGCCGCCCAGG - Intronic
1069859462 10:71461401-71461423 GCCTAAGGCTGTCACAGCCCAGG - Intronic
1070148745 10:73792615-73792637 GCCTGGGGATGTCTGTACCCAGG + Exonic
1070777133 10:79116271-79116293 GGCTGGGGGTGTCTCGACCCTGG + Intronic
1071827522 10:89340068-89340090 GACTGGAGCTGACTGCGCCCTGG - Exonic
1072619977 10:97073458-97073480 GCCAGGGCCTGTCCCAGCCCGGG + Intronic
1072881434 10:99233139-99233161 CCCTGGGGATCTCTCCGTCCGGG - Intronic
1073292534 10:102420349-102420371 GTCTGGGGCTGGGTCCGCCCTGG - Exonic
1075671063 10:124264461-124264483 GCCTGGGGCTGTCTCTGCCCTGG + Intergenic
1076307965 10:129478077-129478099 GCCTGGTGCTGTCCTGGCCCTGG + Intronic
1076639107 10:131901606-131901628 GCCTGGGGCTGCCTCCTGCCCGG + Intronic
1076639120 10:131901641-131901663 GCCCGGGGCTGCCTCCTGCCTGG + Intronic
1076697241 10:132252865-132252887 GCGTGGGGCCGCCTCCTCCCAGG + Intronic
1076763432 10:132616974-132616996 GCCTGGGTCTGTCTGCTCCCTGG + Intronic
1077024497 11:433227-433249 GCCTGGCACTGTCTCCTGCCCGG + Intronic
1077105835 11:842338-842360 GCTGGGGGCTGAGTCCGCCCTGG - Intronic
1077168144 11:1152928-1152950 GCCCGGCACTGTCCCCGCCCTGG + Intergenic
1077186761 11:1238954-1238976 GGCTGTGGCTGCCTACGCCCAGG + Exonic
1077385842 11:2269174-2269196 GCCCGGGGCAGACCCCGCCCGGG + Intronic
1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG + Intergenic
1083155571 11:60820909-60820931 GGCTGGGGCTGCCACTGCCCTGG + Intergenic
1083272329 11:61578783-61578805 GCCTGAGGCTGACTCCTCTCCGG - Intronic
1083668154 11:64286241-64286263 GGTTGGGGGTGTCTCCTCCCTGG - Intronic
1083692616 11:64419553-64419575 GCCTGGCGCTGTGTGAGCCCGGG + Intergenic
1084114404 11:67033393-67033415 GCCTGGGGCTGACTCAACCCTGG + Intronic
1084521813 11:69667781-69667803 GCCTGGGGCTGCGTGCGCCGCGG - Intronic
1084772023 11:71349577-71349599 GCCAGGGGCTGTGCCCCCCCAGG + Intergenic
1088243244 11:107792284-107792306 GCCTGAGGCTGGCTCAGTCCTGG + Exonic
1088802014 11:113314854-113314876 GTCTGGGGCAGGCTCCGCGCGGG + Intronic
1089619279 11:119713267-119713289 GCCCTGGGCTGTCACCTCCCAGG - Intronic
1090807116 11:130209640-130209662 GGCAGGGCTTGTCTCCGCCCAGG + Exonic
1090808636 11:130218536-130218558 GCCTGGTTCAGTGTCCGCCCTGG + Intergenic
1091015680 11:132049256-132049278 GCCTGGGGGTGTCTTCCTCCAGG - Intronic
1091021385 11:132103139-132103161 GCCTGCGCCTGTGTGCGCCCAGG - Intronic
1091696949 12:2634007-2634029 GCGTGGGGCTGTGGCCGCCCCGG - Intronic
1092121403 12:6046589-6046611 GCATGGGTCTGGCTTCGCCCAGG - Intronic
1096385441 12:51192079-51192101 GCCATGGGCTGTCTCCGCTATGG - Intronic
1101131926 12:101698264-101698286 GCCCCGGGCGGTGTCCGCCCTGG + Intronic
1103698588 12:122835770-122835792 GGCAGGGCCTGTGTCCGCCCGGG + Intronic
1103905862 12:124326924-124326946 CCCAGGGTCTGTCTCAGCCCTGG - Intronic
1104981207 12:132573815-132573837 GGGTGGGGCTGTCTCGGCCCTGG + Intronic
1107454931 13:40546242-40546264 CCCTGGAGCTGCCTCTGCCCTGG + Intergenic
1108746296 13:53397964-53397986 CACTGGGGCTGCCTCTGCCCAGG - Intergenic
1111912000 13:94323162-94323184 GGCTGGGGCAGGCTCCGCTCAGG - Intronic
1113025750 13:105939021-105939043 GCCTGGGGCTCTCTGGGCACTGG + Intergenic
1113465716 13:110511726-110511748 GCCTGGGGCTGCCTCCTGCAGGG + Intronic
1113603018 13:111584391-111584413 GCCTGGGGCTGTGTTTGCCTTGG + Intergenic
1113741710 13:112716031-112716053 GCCTGGGGGTGGCTCCTGCCTGG + Intronic
1113856489 13:113449160-113449182 GACTGGGGCTGCCTCCTTCCGGG - Intronic
1113856498 13:113449194-113449216 GACTGGGGCTGCCTCCTTCCGGG - Intronic
1113856507 13:113449228-113449250 GACTGGGGCTGCCTCCTTCCGGG - Intronic
1113887188 13:113667179-113667201 GCCTGGTGCTGTGTCAGCCCCGG + Exonic
1116961516 14:50972919-50972941 GCCTGGGGCTGTCTGCTCAACGG + Intergenic
1118849646 14:69573859-69573881 GCCTGGGTCTCCCTCAGCCCCGG + Intronic
1125687060 15:41569845-41569867 GCCAGGGCCTGTCTCTGACCAGG + Intronic
1127997200 15:64160119-64160141 CCCTGGTGAAGTCTCCGCCCTGG + Exonic
1128058417 15:64718090-64718112 GGATGGGGCTGTCTCTGCCTTGG - Intergenic
1128756378 15:70186410-70186432 CCCTGCGGCTGTCTCTCCCCAGG + Intergenic
1129519440 15:76176624-76176646 GCCTGTGGCTCTCTGTGCCCAGG + Intronic
1129726170 15:77902907-77902929 GACTTGGGCTGTCTCTGACCTGG + Intergenic
1129823684 15:78620747-78620769 CCCTGGCGCTGTCGCCGCCGCGG - Exonic
1130120389 15:81042521-81042543 GCCTGGGGCTGCCTCCCACCTGG - Intronic
1131277418 15:90994084-90994106 GCCCGGGGCGGCCTCCACCCAGG - Intronic
1132665940 16:1081346-1081368 GCCTGGGCCTTTCTCCTGCCAGG - Intergenic
1132672552 16:1107747-1107769 TCCTGGGGCTGTCCTGGCCCCGG - Intergenic
1132712593 16:1276228-1276250 GCCTGGGTCTGTCCTCCCCCAGG - Intergenic
1132720265 16:1312198-1312220 GTCTGGGGCTGCCTCCAGCCCGG + Intronic
1132750341 16:1454702-1454724 GCTTGGGGCCCTCCCCGCCCCGG - Intronic
1132760219 16:1505388-1505410 CCCTGGGCCTGTCTCCCTCCAGG + Exonic
1132989426 16:2785377-2785399 GGCTGGGGCAGCCTCCGCCCAGG - Exonic
1133090661 16:3401395-3401417 GCCTGGGGCTGGCTGGGCCGCGG + Intronic
1133909860 16:10055969-10055991 GCCTGGAGCTGTCTCTAGCCTGG - Intronic
1134091041 16:11391898-11391920 GTCTGGGGCTCTCTCTGCCCTGG - Intronic
1134834241 16:17347859-17347881 GCCAGGAGCTGTCACCACCCTGG + Intronic
1135177400 16:20242809-20242831 GGTAGGGGCTGTCTCTGCCCAGG + Intergenic
1136136463 16:28259382-28259404 TCCTGGAGCTGCCTCCGGCCTGG + Intergenic
1136136943 16:28262000-28262022 GCCTGGCCCTGTCCCCTCCCAGG - Intergenic
1137830586 16:51539646-51539668 GCTCGGGGCTGTCTCTGGCCTGG - Intergenic
1138421109 16:56899776-56899798 GCCGGGGCCTGTCCCCTCCCTGG + Intronic
1139506263 16:67399557-67399579 GCTCGGGGCTGTCTCAGGCCTGG - Intronic
1140507788 16:75484939-75484961 GTGTGGGGCTGTGTCTGCCCAGG - Intronic
1141381360 16:83579944-83579966 GCCTGGGACAGCCTCCGTCCAGG - Intronic
1141637010 16:85319413-85319435 GCCTCAGCCTGTGTCCGCCCTGG + Intergenic
1141677886 16:85527200-85527222 GCCTGGGCTTGTCTCCCCACTGG + Intergenic
1141766862 16:86064563-86064585 GCCTGGGGAAGTCTCGGCTCTGG - Intergenic
1141801946 16:86315713-86315735 GCCTGGGGCATTGTCAGCCCAGG - Intergenic
1142126245 16:88412040-88412062 GCCTGAGGCTGACTCGGCTCTGG - Intergenic
1142223196 16:88865225-88865247 GCCTGGGGCCATCCCCGCCACGG - Intronic
1142668291 17:1474908-1474930 TCCTGGGGCTGTGTCCCCACAGG - Intronic
1142676560 17:1516979-1517001 TCCTTGTGCTGTCTTCGCCCCGG + Intergenic
1143520001 17:7439593-7439615 GTTTGGGGGTGTCTCCTCCCGGG + Exonic
1143631352 17:8142183-8142205 TTCTGGGGCTGGCTCTGCCCTGG - Intronic
1144829857 17:18125237-18125259 GCCTGGGGCTGGCCCTGCCCTGG + Intronic
1145370315 17:22301948-22301970 GCATGGTGCTGTATCCTCCCTGG + Intergenic
1145991293 17:29080793-29080815 GCCTGGGCATGGCTCCTCCCTGG + Intronic
1147890134 17:43711276-43711298 GCCTCTGGCTGTCTCCCCTCAGG - Intergenic
1149649347 17:58267314-58267336 GACTGAGGCTGTCTCATCCCGGG - Intronic
1149684443 17:58527328-58527350 GCCAGGGACTGTCTCAGGCCAGG + Intronic
1149994397 17:61399338-61399360 GCCTGGGGGTCCCTGCGCCCCGG - Intergenic
1150433714 17:65138743-65138765 TCCTAGGACTGTCTCCTCCCAGG + Intronic
1151164554 17:72192593-72192615 CTCTGGGGCTGCCTCCTCCCAGG + Intergenic
1152242156 17:79166337-79166359 GCCAGGAGCTGTAGCCGCCCCGG + Intronic
1152626202 17:81388931-81388953 GCCTGGGGAAGTCTGGGCCCGGG + Intergenic
1152659633 17:81536295-81536317 GGCAGGGGCTGTCTCCACCCAGG + Intronic
1152698365 17:81807176-81807198 GCCTGCCGCTGTCTCCGCCAGGG + Intronic
1152997340 18:420020-420042 GCCTGGCACTGTCTCCTCCTAGG - Intronic
1154176336 18:12088764-12088786 GCCTGGCGCTGGCCCCTCCCTGG + Intergenic
1154415643 18:14174017-14174039 GCCTTGGCCTGTCCCTGCCCTGG - Intergenic
1156501348 18:37561171-37561193 GCCTGGGGGACTCTCAGCCCAGG - Intronic
1157660800 18:49441832-49441854 GCCTGGGGGTCTCTCTCCCCAGG + Intronic
1157807290 18:50667655-50667677 GCCCTGGGCTGTCTCAGCCAGGG - Intronic
1160697371 19:491646-491668 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697387 19:491677-491699 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697400 19:491711-491733 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697417 19:491743-491765 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697426 19:491777-491799 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697444 19:491810-491832 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697455 19:491844-491866 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697472 19:491876-491898 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697483 19:491910-491932 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697500 19:491942-491964 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697509 19:491976-491998 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697527 19:492009-492031 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697538 19:492043-492065 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697555 19:492075-492097 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697566 19:492109-492131 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697594 19:492174-492196 GCCTGGGGCTGGCTCCGCCCAGG - Intronic
1160697607 19:492207-492229 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1160697623 19:492239-492261 GCTTGGGGCTGGCTCCGCCCAGG - Intronic
1161222380 19:3123588-3123610 GCCGGGGGCTGCTGCCGCCCGGG - Exonic
1161260128 19:3333012-3333034 GTCTTGGTCTGTCTCCACCCTGG + Intergenic
1161389997 19:4015834-4015856 GCCTGGCGCGGTCTCCATCCTGG - Intronic
1161400637 19:4065308-4065330 GCCCGGGCCTGACTCAGCCCCGG - Intronic
1161632418 19:5364909-5364931 ACCTGGGCCAGGCTCCGCCCCGG - Intergenic
1162745148 19:12793773-12793795 GCCTGGGGCTTTCCGTGCCCGGG - Intronic
1163633683 19:18429081-18429103 GGCTTGGGCGGCCTCCGCCCTGG - Intronic
1163698536 19:18775869-18775891 GTCTCTGGCTGTCTCCGCACGGG - Intronic
1164638930 19:29811397-29811419 CCTTGGGGATGTCCCCGCCCAGG + Intergenic
1165144867 19:33724601-33724623 GCCTGGGGCTGCATCTGCCTCGG + Intronic
1167093034 19:47357844-47357866 ACCTGGGGCTGTCTCCTCTCAGG + Exonic
1167492818 19:49801921-49801943 GCCTGGGGCTGGGTCCTGCCGGG + Intronic
1168262184 19:55201909-55201931 TCCTGGGGCAGTCTCAGCTCAGG - Intronic
1168262645 19:55205181-55205203 TCCTGGGGCAGTCTCAGCTCAGG - Intronic
1168270789 19:55248689-55248711 GCCTGGGGCTGAGTCAGGCCTGG - Intronic
926885958 2:17599062-17599084 GCCAGGGGCTGTGTAGGCCCTGG + Intronic
927826620 2:26313788-26313810 GCCTGGGCCTGGCTCCACTCAGG - Exonic
927946320 2:27137274-27137296 GCCTGGGACTGGGTCGGCCCGGG + Exonic
928369545 2:30731302-30731324 GCCTGGGACTGTGCCTGCCCCGG + Intronic
929015266 2:37487359-37487381 GCCTTGGGCTGCCTCAGCGCTGG + Intergenic
930024388 2:47021397-47021419 GCCTGGGGCTGTTTTTGTCCTGG - Intronic
930156382 2:48111640-48111662 TCCTGGGAATGTCACCGCCCCGG - Intergenic
930512202 2:52359274-52359296 GCCTGGGGCTCACTTGGCCCTGG + Intergenic
932699724 2:73984721-73984743 GCTTGGGGCAGGCTCCGGCCCGG - Intergenic
933699356 2:85243653-85243675 GCCTGGGGCTGCCTCTGGCCAGG - Intronic
934119175 2:88823742-88823764 GCCTCAGGCTTTCTCAGCCCTGG - Intergenic
934238606 2:90250503-90250525 CCCTGGCCCTGGCTCCGCCCAGG + Intergenic
935396884 2:102619276-102619298 GGCCGGAGCTGTCTCCGCCCCGG - Intergenic
937285235 2:120746442-120746464 GCCTGGGTCTCTCTGCTCCCCGG + Intronic
937323915 2:120977723-120977745 GCCTGGGGCCGTTTTCTCCCAGG + Intronic
937854961 2:126665699-126665721 GCCTGGGGCTGTGCACGCCCTGG + Intronic
937895149 2:126972323-126972345 GCCTGCGGCTGTACCAGCCCTGG + Intergenic
938080952 2:128369857-128369879 GCCTGTGGCTGTCCCTGCCCTGG + Intergenic
944410796 2:199440291-199440313 GCCTGTGGCTGCCTTAGCCCAGG - Intronic
945731835 2:213547693-213547715 GCATGGTCCTGTCTCCACCCAGG + Intronic
946710243 2:222497926-222497948 GCCTGGGACTCTCTCCCCCAGGG - Intronic
948208060 2:236173240-236173262 GCCCGGGTCTGGCTCCGGCCGGG + Intergenic
948353274 2:237358106-237358128 GCCTGGGGCATCCTCCTCCCTGG - Intronic
948712321 2:239832937-239832959 GCCTGAGGCTGTCTCCCCGGAGG - Intergenic
948814402 2:240502529-240502551 GCCTGAGGCTTTCTCGCCCCAGG + Intronic
948853598 2:240719970-240719992 GCCTGGGGCCGTCTTCCCCCAGG + Intronic
948857898 2:240738773-240738795 GCCTGGGTCTGTCACCACTCAGG - Intronic
948869297 2:240790236-240790258 GCCTGAGGCAGTCCCCTCCCAGG + Intronic
1169191329 20:3660695-3660717 TCCAGGGGATATCTCCGCCCGGG - Intronic
1170824665 20:19783474-19783496 AGCTGGGGCTGTCTCTGACCTGG + Intergenic
1172919943 20:38472959-38472981 GGCTGGCGCTTTCACCGCCCTGG - Exonic
1173755598 20:45512907-45512929 GCCAGGGGCTGTGACAGCCCTGG + Intronic
1174114037 20:48214691-48214713 GCCTGGGGCTGGCTGTGCCCTGG + Intergenic
1174167814 20:48597839-48597861 ACCTGGGGCTGGCTGTGCCCTGG - Intergenic
1174182345 20:48682789-48682811 GAATGGGGCTGTTTCCGCCGAGG + Intronic
1175602023 20:60281979-60282001 GCCTGGGGTTTTCTCTCCCCTGG - Intergenic
1176082525 20:63281183-63281205 GCCTGGGGCAGCCTCTGCCTTGG + Intronic
1176084389 20:63289491-63289513 GCCAAGGTCTGTCCCCGCCCAGG + Intronic
1176179590 20:63743048-63743070 TCCTCGGGCTGTTTCAGCCCCGG - Exonic
1176857685 21:13985259-13985281 GCCTTGGCCTGTCCCTGCCCTGG + Intergenic
1176866914 21:14058940-14058962 GCCTTGGCCTGTCCCTGCCCTGG - Intergenic
1179354751 21:40648984-40649006 GCCTGGGCCTTGCTCAGCCCCGG - Intronic
1180187578 21:46147087-46147109 GCCTGGAGCTGGGTCTGCCCTGG + Intronic
1180731423 22:17985220-17985242 GGCAGGGGCTGTCCCCTCCCTGG - Intronic
1180782851 22:18530305-18530327 TCCTGGGGCTGTCGCTGCTCTGG + Exonic
1181126414 22:20704336-20704358 TCCTGGGGCTGTCGCTGCTCTGG + Intergenic
1181239749 22:21469667-21469689 TCCTGGGGCTGTCGCTGCTCTGG + Intergenic
1181516458 22:23416441-23416463 GGCAGGGGCTGTCCCCTCCCTGG - Intergenic
1181938206 22:26454023-26454045 GCCTGGAGTTGGCTCCTCCCAGG - Intronic
1182444100 22:30380263-30380285 CCCTGGGGCTGGCTCCCACCTGG + Exonic
1182472595 22:30557566-30557588 CCCTGGGGCTGTCTCTTTCCAGG - Intronic
1182524217 22:30905741-30905763 GCCTGGCGGTGTCTCCTCCCGGG - Intronic
1183374687 22:37456463-37456485 GACTGGGGTTGGCTCCCCCCGGG - Intergenic
1183716290 22:39535374-39535396 GCCTGGGTGGGTCTGCGCCCAGG + Intergenic
1184186065 22:42866294-42866316 ACCTGGAGCTGACTCCGTCCTGG + Intronic
1184423766 22:44396974-44396996 GGCTGTGGCTGGCTCCTCCCAGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950097120 3:10336932-10336954 CCCTGGTGCTGTCACTGCCCTGG - Intronic
950220483 3:11191646-11191668 GTCTGGGGCTGTCTCCATGCTGG - Intronic
950503638 3:13379623-13379645 GCCGGTGGCTGTCTTGGCCCAGG - Exonic
950543589 3:13626344-13626366 GCCTGGAGCTCTCTCCCTCCTGG + Intronic
954681505 3:52348604-52348626 GCCTGGGCCTGACTCAGCCCAGG - Intronic
957039896 3:75328702-75328724 GGCTGGGGCTGTCTGTCCCCTGG + Intergenic
961363083 3:126380290-126380312 GCCAGGGGCTGTAGCCGCCTGGG - Intergenic
961536165 3:127572289-127572311 GCCTGGGGAGGTCTCAGCCCTGG - Intergenic
963084861 3:141427456-141427478 GCCTGGGGCCTTCCCAGCCCAGG - Intronic
963127234 3:141827333-141827355 GCCTGGGGCTGGCTCCCCCGGGG - Intergenic
964840315 3:160986370-160986392 ACCTGGGCCAGTCTCTGCCCTGG - Intronic
966674753 3:182572719-182572741 GCCTGGGGCTGTGTCTGCCAGGG - Intergenic
968144649 3:196288017-196288039 AACTCGGGCTGTGTCCGCCCAGG + Intronic
968258347 3:197298578-197298600 GCCAGGCGCTGTCTCTGCCGCGG - Intronic
968487076 4:867896-867918 GCCTGTGGCTCTCTCCGCCTGGG + Intronic
968500297 4:946832-946854 GCCTGGGGCTGTTTCCTACAGGG - Intronic
968500310 4:946892-946914 GCCTGGGGCTGTCTCCTACGGGG - Intronic
968500325 4:946953-946975 GCCTGGGGCTGTCTCCTACAGGG - Intronic
968500339 4:947014-947036 GCCTGGGGCTGTCTCCTACAGGG - Intronic
968500369 4:947140-947162 GCCTGGGGCTGTCTCCTACAGGG - Intronic
969717052 4:8872790-8872812 CCCTGGAGCTGTCTCCGTTCCGG + Intergenic
970429673 4:15977167-15977189 GCCTGTGGCAGCCTCCACCCAGG + Intronic
980897633 4:138875196-138875218 GCCTGGGGGTGTCTCCTCCTGGG + Intergenic
985477957 5:90559-90581 GTGTGGGGCTTTCTCAGCCCAGG - Intergenic
987363309 5:17126073-17126095 GCCTGGGGCTGTCTACGTGCTGG - Intronic
997359324 5:133284571-133284593 GCCAGGGGCTGTGTCTGCACAGG - Intronic
997471530 5:134120060-134120082 GGCTGGGGCCGGCTCTGCCCGGG - Intronic
1002132009 5:177087408-177087430 CCCTGCGGCTGTCTTCGCGCCGG + Intronic
1004397582 6:15259466-15259488 GCCTGGTGCTGTCACAGCTCTGG - Intronic
1006259122 6:32853669-32853691 GCCTGGGACTCTCCGCGCCCCGG + Exonic
1006472141 6:34235415-34235437 GCCTGGGGCCGGCTCGGCCTAGG - Intergenic
1006679445 6:35786915-35786937 GCCTGGGGCTTTCTCCCTACGGG - Intronic
1007585141 6:42984772-42984794 GTCTGGGGCTGTCCCGGGCCTGG - Intronic
1009937865 6:70254913-70254935 GAGTGGGGCTGTCTCTGCCCTGG - Intronic
1011627942 6:89298576-89298598 GCCTGGGTCTGTCTTGGCCAAGG + Intronic
1016647223 6:146424249-146424271 GGCAGTGGCTGTCTCCTCCCTGG - Intronic
1017916032 6:158832188-158832210 GCCTAGAGCTGTCTCTGCCAGGG + Intergenic
1018073839 6:160191682-160191704 GCCTGGGGATGTGTCTGCCAGGG - Intronic
1018793537 6:167168901-167168923 CCCTGGGGGTCTCTCTGCCCAGG - Intronic
1018823178 6:167389477-167389499 CCCTGGGGGTCTCTCTGCCCAGG + Intergenic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019153769 6:170025616-170025638 CGCTTGGGCTGTCTCCTCCCGGG - Intergenic
1019340972 7:508788-508810 GGCTGGGGCTGGCACCTCCCTGG - Intronic
1019357902 7:590519-590541 GCCTGGGGCTGTTTTCTCCCCGG - Intronic
1019461416 7:1160756-1160778 GCGTGGGGTTGGCTCTGCCCAGG + Intronic
1019549215 7:1593901-1593923 GCCTGGGGCTGTGTCCCTCTGGG - Intergenic
1019669527 7:2269985-2270007 CTCTGGGGCTGACGCCGCCCCGG - Intronic
1019700812 7:2474386-2474408 GCCTGGGCCAGTCCCCACCCAGG - Intergenic
1019734940 7:2645928-2645950 TCCTGGGGCTGTCTCGGGCTGGG + Intronic
1020210414 7:6154334-6154356 GCCTGGGGCTTTCGGCGCCGCGG - Exonic
1021694919 7:23267185-23267207 GCCTGGGGCTGCGTCTACCCAGG + Intronic
1022094505 7:27130400-27130422 GCCCGGGGCTGGCGCCGCCGCGG + Exonic
1022099051 7:27158241-27158263 GCGCTGGGCTGTCTCCTCCCGGG + Intergenic
1024701434 7:51907990-51908012 ACCTGGGGCTGTCCCCAGCCTGG - Intergenic
1024799284 7:53057661-53057683 ACCTGGGGCTGACCCTGCCCAGG + Intergenic
1026098810 7:67368120-67368142 GACAGGGTCTGTCTCTGCCCAGG - Intergenic
1026673857 7:72412873-72412895 GCCTGGGGCTGTGGCCTCCATGG - Intronic
1026922995 7:74170088-74170110 GGCTGGGGCTTTCTCAGCACTGG - Intergenic
1028496206 7:91463630-91463652 GCCTGTGCCTGGCTCAGCCCCGG - Intergenic
1029506120 7:100965130-100965152 GCCTGTGGCTCTCTCCGTCTGGG + Intronic
1030084129 7:105802802-105802824 GCGTGGGGCTTTCCCCTCCCTGG + Intronic
1030636491 7:111954755-111954777 GCCTCGGCCTGTCTGCACCCAGG + Intronic
1033443762 7:141402775-141402797 GCCTGGGGCTGCCTGCGCACTGG + Intronic
1034069886 7:148174349-148174371 GCCTGATGCTGTCTCTGCTCTGG + Intronic
1034450962 7:151137138-151137160 GCCTGGTGCCGTCTCCCCGCAGG + Intronic
1035332068 7:158102894-158102916 TCCTGGGGGTGTGTCCTCCCGGG - Intronic
1035388396 7:158489624-158489646 GCCTGGAGCTGGGGCCGCCCGGG - Intronic
1035652787 8:1281498-1281520 GTCCAGGGCTGTCTCCGCCGGGG - Intergenic
1036210277 8:6835330-6835352 GGCTGGGGCAGTGCCCGCCCGGG + Intronic
1037788812 8:21919331-21919353 GCCGAGGTCTGTCGCCGCCCCGG - Intergenic
1037820054 8:22131088-22131110 GCCTGGGCCTGCCCCCTCCCGGG + Exonic
1038681400 8:29671700-29671722 GCCTGGAGTTGTCTTCTCCCAGG - Intergenic
1039748579 8:40455945-40455967 ACCTGAGGCTGTCTTCACCCAGG + Intergenic
1039806590 8:41005125-41005147 GCCTGGCTCTGTCTCATCCCAGG + Intergenic
1044754070 8:95443758-95443780 GCCTGGGGCTGCCCAAGCCCAGG - Intergenic
1045017363 8:98010899-98010921 GCCTAGGCCTGCCTCAGCCCTGG - Intronic
1045337848 8:101224403-101224425 GGCTGGGGCTGTCTCCCCCTTGG - Intergenic
1048029348 8:130616319-130616341 GCCTGGGGCTGTTGGAGCCCTGG - Intergenic
1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG + Exonic
1049372747 8:142275488-142275510 CCCTGGGGCTGCCCCGGCCCTGG - Intronic
1049388322 8:142355260-142355282 GCCCGGGGTTGGCTCTGCCCTGG + Intronic
1049476555 8:142799643-142799665 GCCAGGGGCACTCTCCTCCCCGG - Intergenic
1049555184 8:143278068-143278090 GCCTGGGGCCGTCTTCCCCAAGG - Intergenic
1049575662 8:143388633-143388655 GCCAGGGGATGTCTCAGCCTGGG + Intergenic
1053408975 9:37903702-37903724 GCCGGGAGCTGCCTGCGCCCGGG - Exonic
1057082234 9:92181520-92181542 GCCTGGGGCTGGCTCCCGCTGGG + Intergenic
1058877146 9:109254202-109254224 GCCTGGGGCAGTTTCCTCCCAGG + Intronic
1059365941 9:113786552-113786574 TCCTGGGGCTGGCTCAGGCCTGG - Intergenic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1060294282 9:122332645-122332667 GCCCGGTGCTCCCTCCGCCCTGG + Intergenic
1060552924 9:124494094-124494116 GGATGGGGCTGTGTCTGCCCAGG - Intronic
1060770297 9:126327157-126327179 GCCCGGGCCTGTCCCCGCCGCGG - Intronic
1060945430 9:127567458-127567480 GCCTGGGGCTGGCTGGGCACAGG - Intronic
1061412833 9:130430508-130430530 GCCTGGGTCTCTCTCCGTCCGGG + Exonic
1061801807 9:133116850-133116872 GCCTGGCGCTGCCTCTGCCATGG + Intronic
1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG + Intergenic
1062029552 9:134356059-134356081 GCTTGGGCCTGTCTCAGGCCAGG + Intronic
1062169225 9:135125510-135125532 CCCTGGGGCTGTCCATGCCCTGG + Intergenic
1062389713 9:136329122-136329144 GCCAGGGGCTGGCTCCTGCCTGG - Intronic
1062389743 9:136329226-136329248 GTCTGGGCCTGACTCCACCCTGG - Intronic
1062506750 9:136881598-136881620 GCCTGGGGCTGGCTGTGGCCAGG - Intronic
1062567508 9:137169862-137169884 GCCTTGGCCTGTCTGGGCCCAGG - Exonic
1187077157 X:15946905-15946927 TCCTGGAGCTGTCTCTTCCCTGG - Intergenic
1187172914 X:16869741-16869763 GGCGGGGGCCGCCTCCGCCCCGG + Exonic
1190265762 X:48826584-48826606 GCCTGGGGGTATCCCCGCGCCGG + Intergenic