ID: 1160699222

View in Genome Browser
Species Human (GRCh38)
Location 19:498045-498067
Sequence GCCGGGACCCGCGTGTGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160699214_1160699222 8 Left 1160699214 19:498014-498036 CCTCACCGTGCGCAACGCCTCGC 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1160699222 19:498045-498067 GCCGGGACCCGCGTGTGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1160699215_1160699222 3 Left 1160699215 19:498019-498041 CCGTGCGCAACGCCTCGCTGTCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1160699222 19:498045-498067 GCCGGGACCCGCGTGTGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1160699213_1160699222 17 Left 1160699213 19:498005-498027 CCGCAGCGTCCTCACCGTGCGCA 0: 1
1: 0
2: 9
3: 32
4: 153
Right 1160699222 19:498045-498067 GCCGGGACCCGCGTGTGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 59
1160699220_1160699222 -9 Left 1160699220 19:498031-498053 CCTCGCTGTCGGCGGCCGGGACC 0: 1
1: 0
2: 1
3: 22
4: 77
Right 1160699222 19:498045-498067 GCCGGGACCCGCGTGTGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160699222 Original CRISPR GCCGGGACCCGCGTGTGCGT GGG Exonic