ID: 1160700017

View in Genome Browser
Species Human (GRCh38)
Location 19:501718-501740
Sequence GTCTCCCGACACCACCTCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 2, 2: 3, 3: 16, 4: 244}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160700009_1160700017 0 Left 1160700009 19:501695-501717 CCTCCCGACACCACCTCCCCGGA 0: 2
1: 0
2: 5
3: 17
4: 269
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700011_1160700017 -4 Left 1160700011 19:501699-501721 CCGACACCACCTCCCCGGAGTCT 0: 2
1: 1
2: 2
3: 19
4: 252
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700010_1160700017 -3 Left 1160700010 19:501698-501720 CCCGACACCACCTCCCCGGAGTC 0: 2
1: 1
2: 4
3: 10
4: 189
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700004_1160700017 11 Left 1160700004 19:501684-501706 CCTCCCCGGAGCCTCCCGACACC 0: 1
1: 3
2: 1
3: 20
4: 271
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700007_1160700017 6 Left 1160700007 19:501689-501711 CCGGAGCCTCCCGACACCACCTC 0: 1
1: 2
2: 3
3: 34
4: 350
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700012_1160700017 -10 Left 1160700012 19:501705-501727 CCACCTCCCCGGAGTCTCCCGAC 0: 2
1: 1
2: 1
3: 15
4: 163
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700002_1160700017 16 Left 1160700002 19:501679-501701 CCCGACCTCCCCGGAGCCTCCCG 0: 1
1: 0
2: 3
3: 18
4: 391
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700005_1160700017 8 Left 1160700005 19:501687-501709 CCCCGGAGCCTCCCGACACCACC 0: 1
1: 3
2: 1
3: 17
4: 176
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160699999_1160700017 30 Left 1160699999 19:501665-501687 CCAGTCCTGCACAGCCCGACCTC 0: 1
1: 0
2: 2
3: 14
4: 197
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700003_1160700017 15 Left 1160700003 19:501680-501702 CCGACCTCCCCGGAGCCTCCCGA 0: 1
1: 0
2: 1
3: 13
4: 295
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700000_1160700017 25 Left 1160700000 19:501670-501692 CCTGCACAGCCCGACCTCCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244
1160700006_1160700017 7 Left 1160700006 19:501688-501710 CCCGGAGCCTCCCGACACCACCT 0: 2
1: 2
2: 2
3: 20
4: 174
Right 1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG 0: 2
1: 2
2: 3
3: 16
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160700017 Original CRISPR GTCTCCCGACACCACCTCCC CGG Exonic
900226688 1:1536367-1536389 GGCCTCCGACAGCACCTCCCAGG - Intronic
900927417 1:5714338-5714360 GTCTCCAGACACCACCACCCTGG + Intergenic
901812698 1:11776821-11776843 GTGTCCCTAGGCCACCTCCCAGG - Intronic
902396561 1:16135105-16135127 GGCCCCAGACACCACCTACCTGG - Exonic
902611990 1:17602957-17602979 TCCTCCCCACACCAGCTCCCAGG - Intronic
903296096 1:22343898-22343920 GTCGCCCATCACCTCCTCCCGGG - Intergenic
903468595 1:23569022-23569044 GCCTCCCCACAGCTCCTCCCTGG - Intergenic
903889372 1:26559177-26559199 GTCACTCGGCACCACCACCCTGG - Intronic
904239042 1:29132230-29132252 GACCCCCATCACCACCTCCCAGG - Intergenic
905328467 1:37175269-37175291 CTCTCCCCAGACCTCCTCCCTGG + Intergenic
906301820 1:44688015-44688037 GTGTCTCAACCCCACCTCCCTGG + Intronic
906733247 1:48101174-48101196 GTCTCCTGACACCAGCCCTCAGG - Intergenic
907289552 1:53404230-53404252 CTCTCCCCACTCCACCTGCCTGG + Intergenic
909898094 1:81099133-81099155 TTCTCCCGTCTCAACCTCCCAGG + Intergenic
910410655 1:86940916-86940938 CTCACCCGACTGCACCTCCCAGG - Intronic
911073959 1:93855145-93855167 TTCTCTCCAAACCACCTCCCTGG - Intergenic
915622066 1:157092107-157092129 GTCTCCCCACCCCACTTGCCTGG + Exonic
919819144 1:201462026-201462048 GTCTCCCCACCCCACCTCATCGG + Intergenic
919983512 1:202657398-202657420 GGGTCCTGACCCCACCTCCCAGG - Intronic
920159920 1:203988760-203988782 GTCTCCAAACACCATCACCCTGG - Intergenic
920957676 1:210633952-210633974 GTCTCCAGACAGCACATCTCAGG + Intronic
922804041 1:228376702-228376724 GTCTCCCATCACCCCTTCCCAGG - Intronic
924235869 1:241999166-241999188 CTCTCCCCACTCCCCCTCCCTGG + Intergenic
1063157953 10:3397287-3397309 GTCTCCAGACACCAACCCTCTGG + Intergenic
1067005262 10:42654959-42654981 GTCCCACAACACCACCTCTCAGG + Intergenic
1067693557 10:48519780-48519802 GGCTCCCCAGACCACCTCTCTGG - Intronic
1069947984 10:72000596-72000618 TTCTCCCAACACCCCCACCCTGG - Intronic
1070751760 10:78968086-78968108 CTCCCCAGACAACACCTCCCAGG + Intergenic
1071285623 10:84141523-84141545 GTCTCCGGACACTACCTTCTAGG + Exonic
1071585804 10:86820116-86820138 GTCTGCAGCCTCCACCTCCCAGG + Intronic
1071633063 10:87231446-87231468 GTCTCCCCAACCCAACTCCCTGG - Intronic
1071646512 10:87363664-87363686 GTCTCCCCAACCCAACTCCCTGG - Intronic
1071676491 10:87660101-87660123 TCCTCCCGACGCCCCCTCCCGGG - Intronic
1072799135 10:98380680-98380702 GTCTCTGGACACCATCACCCAGG + Intergenic
1075030477 10:119021336-119021358 GTCTCCCTCCTCCACCTTCCAGG - Intergenic
1077221801 11:1421212-1421234 GTCTCCTGACACCCCGTCCTGGG - Intronic
1077307413 11:1874376-1874398 GTCTCCCGACACCCCTTCCCGGG + Intronic
1079218716 11:18539145-18539167 GGCTCACTGCACCACCTCCCAGG + Intronic
1081501518 11:43671253-43671275 TTCTCCAGCCTCCACCTCCCAGG + Intronic
1082077113 11:47982252-47982274 GTCTCCTGACATCTACTCCCAGG - Intronic
1082568900 11:54714150-54714172 GTCTCTAGACACCACCTCTGGGG - Intergenic
1083237648 11:61361947-61361969 GTCTCCGGACTTCACTTCCCAGG - Exonic
1083651962 11:64209133-64209155 AGCTCCCTACACCACCTCTCAGG - Intronic
1084795540 11:71502285-71502307 CTATCCCGACAGCACCTCCTGGG - Intronic
1084795685 11:71502987-71503009 CTATCCCGACAGCACCTGCCGGG - Intronic
1089292297 11:117444549-117444571 TTCTCCCGCCCCCTCCTCCCTGG - Intronic
1089328357 11:117672980-117673002 GCCTCCCCAGACCACCTGCCTGG + Intronic
1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG + Intronic
1089848727 11:121479207-121479229 CCCTCCCGCCTCCACCTCCCTGG - Intronic
1092365831 12:7876171-7876193 TTCTCCTGCCTCCACCTCCCAGG - Intronic
1093553129 12:20438865-20438887 TTCTCCTGCCTCCACCTCCCAGG + Intronic
1093648914 12:21621007-21621029 TTCTCCCGCCTCCACCTCCCAGG + Intergenic
1095755615 12:45763360-45763382 TTCTCCTGCCTCCACCTCCCCGG - Intronic
1097152694 12:56991312-56991334 GCCTCCCAATACCTCCTCCCTGG + Intergenic
1098028961 12:66235065-66235087 GCCTCCCCACACCACCGACCAGG - Intronic
1098330049 12:69343735-69343757 GGCTGCCAAAACCACCTCCCAGG - Intergenic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1101443772 12:104722761-104722783 GTCTCCCCTCACCTCCCCCCAGG - Intronic
1102460036 12:113094367-113094389 GGCTCCCCTCACCACCCCCCAGG - Intronic
1102600755 12:114028447-114028469 GTCTCCCAACACTATGTCCCAGG + Intergenic
1103339519 12:120214069-120214091 GTCTCCCACCCCCACCTCCCCGG + Intronic
1105378255 13:19863894-19863916 GTCTCCCGCCCCCAGCTACCGGG + Intergenic
1106242245 13:27921264-27921286 GTCTCCCCGCACCGCTTCCCAGG + Intronic
1106934741 13:34705565-34705587 CTCTCCTGCCTCCACCTCCCAGG + Intergenic
1107542205 13:41401552-41401574 GCCTGGTGACACCACCTCCCTGG + Intergenic
1113638478 13:111938955-111938977 GGCTCCTGAGCCCACCTCCCAGG + Intergenic
1113785902 13:113002014-113002036 GTCGCCCCACAACACCTTCCGGG - Intronic
1115307226 14:31945324-31945346 CTTCCCTGACACCACCTCCCTGG + Intronic
1118757315 14:68854243-68854265 TTCTCCAGACACGCCCTCCCTGG + Intergenic
1120135912 14:80868059-80868081 GTCTCCCCCCACCCCCTGCCAGG - Intronic
1121761082 14:96445550-96445572 TCCTCCCGCCTCCACCTCCCGGG - Intronic
1122695436 14:103549986-103550008 GACTCCTGCCACCACCTACCTGG - Intergenic
1122864430 14:104597154-104597176 CTCACTGGACACCACCTCCCAGG + Intronic
1123984230 15:25630834-25630856 GACTCTGGACAGCACCTCCCAGG - Intergenic
1124990619 15:34669822-34669844 GTCATCCAACTCCACCTCCCTGG - Intergenic
1125042572 15:35208199-35208221 CTCCCCCGCCACCACCTCCAGGG - Intergenic
1125187215 15:36944836-36944858 TTATCTCGACCCCACCTCCCTGG + Intronic
1126100015 15:45113276-45113298 CTCTCCCCGCCCCACCTCCCAGG + Intronic
1129362628 15:75033879-75033901 GCCTCCCTAGACCACCTCCCTGG + Intronic
1129674636 15:77625844-77625866 GTCTGCCGTCCCCACTTCCCAGG - Intronic
1130108090 15:80943938-80943960 GTCTCCCCACATCGCCTCCTCGG + Intronic
1130736368 15:86554449-86554471 CTCTCTCCACACCACCACCCGGG - Exonic
1131206343 15:90451588-90451610 GCCTCCCAACACCACCACACTGG + Intronic
1131816901 15:96231404-96231426 TTCTCCTGTCTCCACCTCCCAGG - Intergenic
1133018210 16:2954736-2954758 GGCCCCCAACACCGCCTCCCAGG - Intergenic
1133257092 16:4523717-4523739 CTCTTCCGCCACCTCCTCCCAGG - Intronic
1133277624 16:4648249-4648271 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133277660 16:4648357-4648379 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133277769 16:4648642-4648664 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1133277808 16:4648750-4648772 GTCACCCGGCTCCTCCTCCCGGG + Intronic
1136229499 16:28878269-28878291 CTCTCCCTACCCCACTTCCCTGG + Intergenic
1136719632 16:32310053-32310075 GTATACCGACACCCCCTCTCCGG + Intergenic
1136782471 16:32915638-32915660 CTCTCCCGGCACCAGCTCCTGGG - Intergenic
1136838006 16:33516333-33516355 GTATACCGACACCCCCTCTCCGG + Intergenic
1136887321 16:33938213-33938235 CTCTCCCGGCACCAGCTCCTGGG + Intergenic
1140047990 16:71455192-71455214 GTGTGCCGCCACCACCACCCTGG + Intronic
1141363275 16:83417451-83417473 CTGTCGTGACACCACCTCCCTGG + Intronic
1141616212 16:85211159-85211181 GGATCCCGACACCACCCCTCTGG + Intergenic
1203006799 16_KI270728v1_random:207716-207738 GTATACCGACACCCCCTCTCCGG - Intergenic
1203085131 16_KI270728v1_random:1179625-1179647 CTCTCCCGGCACCAGCTCCTGGG - Intergenic
1142473384 17:175879-175901 GACACCCGTCACCACCTCCTGGG + Intronic
1142552603 17:750343-750365 ATCTCCTGACCCCATCTCCCCGG + Intronic
1142597677 17:1037459-1037481 GTGTCCCGACAGCCCGTCCCTGG + Intronic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1145919932 17:28603004-28603026 TTCTCCCACCTCCACCTCCCTGG + Intronic
1145961969 17:28892106-28892128 GCCTCCCCACCCCACTTCCCAGG - Intronic
1147546042 17:41402565-41402587 TTCTGCCCACACCACATCCCTGG - Intergenic
1147705509 17:42422548-42422570 GTCTCCCCACCCCAACTCCCAGG + Intronic
1147896776 17:43756515-43756537 ATCTCCGGACTCCACTTCCCTGG + Intronic
1148157861 17:45433493-45433515 CTCTCTTGACACCACCTCCTGGG + Intronic
1148360964 17:47011471-47011493 TTCACCCTCCACCACCTCCCAGG - Intronic
1148578540 17:48727906-48727928 GTCTCCCTCCTCCTCCTCCCAGG + Intronic
1149571539 17:57675669-57675691 GGATCCCCACACCACCTCCCGGG - Intronic
1149598729 17:57879610-57879632 CTCCCCCGACTCCGCCTCCCCGG - Exonic
1149994511 17:61399714-61399736 GGCTTCCGACACCTTCTCCCAGG + Intergenic
1150703633 17:67468802-67468824 TTCTCCTGCCTCCACCTCCCAGG + Intronic
1151360337 17:73584819-73584841 CTCTCCTGCCACCACATCCCTGG + Intronic
1151496283 17:74460123-74460145 GTCTGCAGCCTCCACCTCCCGGG + Intergenic
1152091349 17:78249478-78249500 GTCTCTCCTCTCCACCTCCCAGG - Intergenic
1152967877 18:133040-133062 ATCTCCACTCACCACCTCCCGGG - Intergenic
1157918250 18:51691065-51691087 GCCCACAGACACCACCTCCCAGG + Intergenic
1160496121 18:79376800-79376822 TTCTCCTGTCTCCACCTCCCCGG + Intronic
1160700008 19:501694-501716 GCCTCCCGACACCACCTCCCCGG + Exonic
1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG + Exonic
1160700025 19:501742-501764 GTCTCCCGACACCACCTCCCAGG + Exonic
1160700032 19:501766-501788 GCCTCCCGACACCACCTCCCCGG + Exonic
1160700041 19:501790-501812 GCCTCCCGACAAGACCTCCCCGG + Exonic
1160802847 19:978376-978398 TTCTCCCAACTCAACCTCCCAGG + Intergenic
1161058094 19:2200593-2200615 GGCTGCTGACCCCACCTCCCCGG - Intronic
1161067152 19:2244276-2244298 AGCCCCCGACACCACCTTCCTGG - Intronic
1161210541 19:3063004-3063026 GTCTCCAGGCACCACCACCAGGG - Exonic
1161444599 19:4311125-4311147 TCCTCCCGAGACCTCCTCCCTGG + Intronic
1161478369 19:4498580-4498602 GCCTCCACACACCACCTGCCGGG - Intronic
1161863918 19:6820209-6820231 GCCTCCTGCCTCCACCTCCCAGG - Intronic
1162537063 19:11269000-11269022 CTCTCCTGACGCCACCTCACTGG - Intergenic
1163547509 19:17948603-17948625 CTCCCCCGTCACCCCCTCCCTGG - Intergenic
1163754081 19:19096251-19096273 GCCTCCCCACCCCCCCTCCCAGG + Intronic
1163832278 19:19552770-19552792 GTTTCCCCACACCGCCCCCCCGG - Intergenic
1165302979 19:34983810-34983832 GTCACCCAACACCACCACACTGG - Intergenic
1166177589 19:41085983-41086005 GTCTCTCCCCACCCCCTCCCTGG + Intergenic
1166298774 19:41902686-41902708 GTCTCCAGGCCCCTCCTCCCTGG - Intronic
1166747809 19:45150163-45150185 GGCTCCAGCCACCACCTCCCGGG + Exonic
1166943777 19:46384671-46384693 GCCTCCTGTCAGCACCTCCCAGG - Intronic
1167284017 19:48588757-48588779 GGCTCCCACCATCACCTCCCGGG - Intronic
1168305600 19:55433440-55433462 GCCCCCCGACCCCACCGCCCGGG - Exonic
925047336 2:782691-782713 GGCCCCAGAGACCACCTCCCTGG - Intergenic
926013483 2:9427005-9427027 CTTTCCCCAGACCACCTCCCAGG - Intronic
926081558 2:9990752-9990774 GTGTCCTGACCCCAGCTCCCAGG + Intronic
926148524 2:10411633-10411655 GTCCCCAGTCACCAGCTCCCTGG - Intronic
927872972 2:26635298-26635320 GTCTCCCCCCACCAGCCCCCAGG + Intronic
930719617 2:54626596-54626618 TTCTCCCCATACCACCTCTCCGG - Intronic
932181427 2:69650009-69650031 GACTGCAGCCACCACCTCCCGGG + Intronic
932186310 2:69699232-69699254 GTCTCCTGGCCCCACCTTCCAGG + Intronic
932605572 2:73163251-73163273 GTCTCCCAACTCCCACTCCCTGG - Intergenic
935297212 2:101660531-101660553 TTCTCCTGTCTCCACCTCCCGGG + Intergenic
935714782 2:105930341-105930363 TTGTCCCCACACCACCTCCCAGG - Intergenic
937024260 2:118684195-118684217 GGCGCCCGACACCACGCCCCTGG - Intergenic
937462061 2:122098032-122098054 TTCTCACAAGACCACCTCCCTGG + Intergenic
939884280 2:147664378-147664400 CTCTCCCTACCCCACCTCCCTGG - Intergenic
941016827 2:160367238-160367260 GCCTCCCCACACCACCGACCAGG - Exonic
947300350 2:228682260-228682282 GGCTTCCAAGACCACCTCCCTGG - Intergenic
947538143 2:230953912-230953934 GTCTCCTGGAACCACCTTCCTGG + Intronic
948687380 2:239677641-239677663 GTGTCCCCACACCTCCTCCAGGG + Intergenic
948941590 2:241199621-241199643 TTCACCCGACCCCACCTCCCGGG - Intronic
1172511477 20:35504020-35504042 GTCTCCCAGCACCTCCTCCAGGG - Exonic
1173589122 20:44210565-44210587 GTCTCCCGACGCCTCCTGCCTGG - Intronic
1173662564 20:44744763-44744785 GGCGCCCAACTCCACCTCCCCGG + Intergenic
1175269821 20:57725849-57725871 GTCTCCCCACACTAGCTGCCTGG - Intergenic
1175870874 20:62208872-62208894 GTCTCCCGGCAACCCCTCCCGGG - Intergenic
1175999295 20:62824911-62824933 ACCCCCCGACACCCCCTCCCTGG - Intronic
1176139378 20:63538315-63538337 GACTCGGGACACCCCCTCCCTGG + Intergenic
1176911203 21:14567169-14567191 GTCTTCTGACAACACCGCCCTGG - Intronic
1178171110 21:30040688-30040710 GAGGCCTGACACCACCTCCCGGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1181146438 22:20851411-20851433 AGCTCACCACACCACCTCCCGGG + Intronic
1181886659 22:26027118-26027140 GACTCCAGACACCGCCTCCGAGG - Exonic
1182578445 22:31289685-31289707 ATCTCCAGAGACCACCTCCCAGG - Exonic
1183214278 22:36468964-36468986 GACTCCAGCCTCCACCTCCCAGG - Intronic
1183744879 22:39686359-39686381 GTCTCCCGGCTCCAGCTCTCCGG - Exonic
1184469978 22:44690865-44690887 GTCTCCCGCCACGCCCTGCCAGG - Intronic
1184583669 22:45433720-45433742 GCCTCCCCACACCTCCTGCCTGG - Intergenic
1184749657 22:46478014-46478036 GTCTCCAGACAACACCTGCCAGG + Intronic
950172742 3:10850882-10850904 TTCTCCTGCCACCTCCTCCCTGG - Intronic
957043350 3:75354228-75354250 TTCTCCTGTCTCCACCTCCCAGG - Intergenic
961511613 3:127407126-127407148 CTCCCCGGAGACCACCTCCCTGG + Intergenic
962198121 3:133380503-133380525 GGCACCCACCACCACCTCCCTGG + Exonic
962467189 3:135671683-135671705 ATCTCCCTAGACCCCCTCCCTGG + Intergenic
966974413 3:185071726-185071748 GTCTCCTCACACCACATCCTGGG + Intergenic
968526353 4:1059602-1059624 GTCTCCCCTCACTCCCTCCCTGG + Intronic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
969095347 4:4728661-4728683 GTCTCTGGAGTCCACCTCCCTGG + Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
969681025 4:8643591-8643613 GTCTCCAGACACCATCACACGGG - Intergenic
971828467 4:31659147-31659169 GCCTCCCAACACCACCTCATGGG - Intergenic
972580995 4:40395580-40395602 GTCTCAGGAGACCACCACCCAGG - Intergenic
972583700 4:40417648-40417670 TTCTCCCGAGACCACGTCGCTGG - Intergenic
973871490 4:55171060-55171082 GGCTCACCGCACCACCTCCCAGG - Intergenic
978761263 4:112357958-112357980 GTCTACCGGCGCCACCTTCCTGG + Intronic
980101336 4:128544106-128544128 GTCTCCCGTTCCCAGCTCCCCGG - Intergenic
981587145 4:146316343-146316365 GTCTCCCAATACCAGCACCCAGG - Intronic
984714918 4:182917026-182917048 GACGCCCAGCACCACCTCCCGGG + Intronic
984839143 4:184051985-184052007 GTCTCCCTGCCCCACCTGCCAGG - Intergenic
985535648 5:464552-464574 CTCTGCGGACGCCACCTCCCTGG + Intronic
985657090 5:1137828-1137850 CTCCCCCGGCACCAGCTCCCCGG + Intergenic
985761007 5:1748700-1748722 CTCACAAGACACCACCTCCCTGG - Intergenic
990381652 5:55226182-55226204 TTCTCCCAACACCCCCTTCCTGG - Intronic
990869500 5:60415688-60415710 GTCTCCCCACACCCCCACCATGG + Intronic
997394518 5:133547512-133547534 ATCTCCCAACACCACCACACTGG - Intronic
997611904 5:135221263-135221285 ATCTCCACCCACCACCTCCCAGG - Intronic
999747702 5:154604801-154604823 GTCCCCAGACACCAAATCCCAGG + Intergenic
1001075515 5:168624774-168624796 GCCCCCCCACTCCACCTCCCAGG + Intergenic
1002522832 5:179800868-179800890 CTCTCCCGCCACCAGCTCTCTGG + Intronic
1002760764 6:200201-200223 GTATCCCGACACCTACTGCCTGG + Intergenic
1004499715 6:16198468-16198490 GTCTCCCCACACCTCCCCACAGG + Intergenic
1006030091 6:31171855-31171877 TTCTCCCTCCCCCACCTCCCTGG + Intronic
1006094190 6:31645436-31645458 GTCTCACTACACCACCCCCATGG - Exonic
1006359720 6:33580356-33580378 CTTTCCCCACCCCACCTCCCAGG + Intergenic
1006766732 6:36513125-36513147 TTCTCCTGCCTCCACCTCCCAGG + Intronic
1011290022 6:85767036-85767058 GTCTCCCAACACCAATACCCAGG - Intergenic
1013033658 6:106360494-106360516 GACTCCCGACACTGCATCCCAGG - Intergenic
1013152386 6:107459183-107459205 GTCCCTCGACACCATCTCCTCGG - Exonic
1014009405 6:116459038-116459060 GTCTCTAAACACCACCTCCTGGG - Intergenic
1014021413 6:116594237-116594259 ATCTCCCAACACCACCACACTGG + Exonic
1014653826 6:124074240-124074262 GTCACCCGACACCTTCTGCCTGG + Intronic
1018904100 6:168065130-168065152 CCCTCCCCACACCAGCTCCCAGG + Intronic
1019451875 7:1103087-1103109 GTCTCCCGGGCCCTCCTCCCTGG + Intronic
1019614072 7:1950983-1951005 GTCCCCCGCCTCCTCCTCCCAGG - Intronic
1019783664 7:2959591-2959613 GCCTGTCGCCACCACCTCCCCGG - Intronic
1020040840 7:4999668-4999690 GTCTCCTGGCCCCACCTTCCAGG + Intronic
1021161122 7:17274088-17274110 ATCTCCCAACACCACCACACTGG - Intergenic
1023821828 7:43984952-43984974 GTGTCCCTACACCTCCTCCCTGG - Intergenic
1024136148 7:46411439-46411461 TTCTGGTGACACCACCTCCCTGG + Intergenic
1024791398 7:52968453-52968475 GTCTGCAGCCTCCACCTCCCAGG - Intergenic
1024845312 7:53635428-53635450 CACTGCCAACACCACCTCCCGGG - Intergenic
1028928562 7:96387500-96387522 GTCTCCTGACTCAGCCTCCCAGG - Intergenic
1029750094 7:102538374-102538396 GTGTCCCTCCACCTCCTCCCTGG - Intronic
1029768045 7:102637482-102637504 GTGTCCCTCCACCTCCTCCCTGG - Exonic
1033230722 7:139595345-139595367 GTGCCCCCACACCACCACCCAGG - Intronic
1033510459 7:142055703-142055725 TTCTCCCGAGACCAGCCCCCAGG + Exonic
1033513308 7:142082187-142082209 TTCTCCCGAGACCAGCCCCCAGG + Intronic
1033601842 7:142894127-142894149 GTGTCCCTACTCCACCTCCAGGG - Intergenic
1035472602 7:159119821-159119843 TTCTTCCGACCCCACCTACCAGG - Intronic
1035472625 7:159119918-159119940 TTCTTCCGACCCCACCTACCAGG - Intronic
1035472635 7:159119966-159119988 TTCTTCCGACCCCACCTACCAGG - Intronic
1037535258 8:19817578-19817600 GTCTTGCGGCACCAACTCCCGGG - Exonic
1037633703 8:20680813-20680835 TTCTCCCGACTCAGCCTCCCAGG + Intergenic
1039436222 8:37561215-37561237 CTCTCCCGTCTCCACATCCCAGG + Intergenic
1040900321 8:52411143-52411165 GTCTCCCGGCTCCTGCTCCCAGG - Intronic
1046871307 8:119208411-119208433 GCCTCCCGCCTCCGCCTCCCGGG - Exonic
1049211955 8:141391076-141391098 GTCTCCAGACACCACCTCACTGG - Intergenic
1049792488 8:144478346-144478368 GTCTCCCGAGGGCCCCTCCCCGG - Intronic
1056845466 9:90033462-90033484 GACTCCTCACACCACCTCTCAGG - Intergenic
1056992726 9:91425516-91425538 GTTCCCCGACACCATCTTCCCGG + Intergenic
1057182066 9:93035638-93035660 GGCCTCCAACACCACCTCCCAGG - Exonic
1057922120 9:99105565-99105587 TCCGCCCGACTCCACCTCCCCGG - Intronic
1060423873 9:123488624-123488646 GCCTCCCCACTCCACGTCCCTGG + Intronic
1060907180 9:127317128-127317150 GTCTCCCGTCCACACCACCCAGG - Intronic
1061664401 9:132151980-132152002 GTCTCCCCATCCCACTTCCCAGG - Intergenic
1062018188 9:134302749-134302771 GTCACCTGTCACCACCTCTCTGG - Intergenic
1062400392 9:136370195-136370217 GTCTCCACACCCCACCTTCCAGG + Intronic
1185493057 X:533727-533749 TTCTCCTGCCTCCACCTCCCAGG + Intergenic
1185591850 X:1282589-1282611 GTTTCCCCAAATCACCTCCCTGG + Intronic
1187518017 X:19990533-19990555 GTCCCCGGACACCGCCTTCCCGG + Intergenic
1187701295 X:21966554-21966576 GTCTCCCCACCCCACCCCCATGG - Intronic
1188165534 X:26858414-26858436 TTCTCCCGCCTCAACCTCCCAGG + Intergenic
1189298848 X:39937700-39937722 ACCTCCCGACACCACCACCAGGG + Intergenic
1199821028 X:151446563-151446585 TTCTCACAACACCATCTCCCTGG - Intergenic