ID: 1160700613

View in Genome Browser
Species Human (GRCh38)
Location 19:505206-505228
Sequence CAATGTATGTAAAAAGTACG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160700613 Original CRISPR CAATGTATGTAAAAAGTACG TGG (reversed) Exonic
903582268 1:24380425-24380447 CAATGTTTGTCAAAAGAACAGGG + Intronic
905057931 1:35114042-35114064 CAATGTATGTATAAAGCTCTTGG - Exonic
908369249 1:63464614-63464636 CAATGTATGTTAAAACTACTGGG + Intronic
911132352 1:94401989-94402011 CAATGTATGATAAAAGAAAGTGG - Intergenic
913354764 1:117907512-117907534 GAATGTAGGTAAAAAGGACCAGG - Intronic
922535776 1:226379677-226379699 AAATGTAACTAAAAAGTAAGGGG + Intronic
923620029 1:235571212-235571234 AAATGTATGTTAAAATAACGAGG + Intronic
1062932327 10:1361401-1361423 CAATGTAAGTAAAAACAAGGTGG - Intronic
1063054971 10:2495079-2495101 CCATGTATTTAAAAAATACGTGG - Intergenic
1065278403 10:24109694-24109716 GAATAAATGTAAAAAGAACGAGG + Intronic
1065681736 10:28242117-28242139 AAATGTATTTGAAAAGTACTTGG - Intronic
1066031052 10:31425425-31425447 TAATGTTTCTAAAAAGAACGTGG + Intronic
1068639481 10:59387195-59387217 CAATGTAGGTACAAAGTGCTTGG - Intergenic
1070983825 10:80671269-80671291 CAAGGTGTGAAAAAAGTAAGTGG - Intergenic
1071199140 10:83198014-83198036 CCATGTAGGTTAAAAGTAAGGGG - Intergenic
1071666395 10:87563007-87563029 CAATGTTAGTAAAAAGTGCTTGG - Intergenic
1072128686 10:92471184-92471206 TAATATATGTAAAAAGAAAGAGG - Intronic
1073876535 10:107929145-107929167 CAGTGTATGTAAAAAGAGTGAGG - Intergenic
1075824239 10:125340828-125340850 CAATATTTGTAAGAAGTAGGTGG + Intergenic
1075991210 10:126840375-126840397 CAATATATGTAAGAAGTACACGG - Intergenic
1078011274 11:7574852-7574874 CAACGTAAGTAAAATGTACTTGG + Intronic
1079149960 11:17889163-17889185 CAATGCATGTTAAAACTACTGGG + Intronic
1081341557 11:41934077-41934099 CAATAACTGTAAAAAGTAAGTGG + Intergenic
1082140289 11:48601204-48601226 CAATGAATGTAAACTGTACCTGG - Intergenic
1082701712 11:56440465-56440487 CAATGTAGGAAAAAAGAATGTGG - Intergenic
1082761589 11:57131909-57131931 CAATGCATGTACAAAATAAGAGG + Intergenic
1087313631 11:96579578-96579600 AAATGTATTTTAAAAGTAAGAGG - Intergenic
1087521766 11:99247176-99247198 CAATGAATGTTAAGAGTAGGAGG + Intronic
1087903662 11:103670928-103670950 CAATATATGTTAAAAGTGCCTGG - Intergenic
1092520710 12:9269789-9269811 CAGAGTATGTAAAAAGTCCAGGG - Intergenic
1093230367 12:16536324-16536346 CTGTGTATGAAAAAACTACGTGG + Intronic
1094339332 12:29393212-29393234 CAATGTAGGTTAAAAGTAGAGGG + Intergenic
1094541497 12:31366657-31366679 AAATGAATATAAAAAGTATGAGG - Intergenic
1094568407 12:31620601-31620623 CATTGTAGGTAAAAAGGATGTGG - Intergenic
1095578548 12:43767571-43767593 CAAAGTATGTGAAAAGTGGGTGG + Intronic
1099453622 12:82838033-82838055 TAATGTATATAAAAAATACTTGG + Intronic
1099532683 12:83804498-83804520 CAAAGCATTTAAAAAGTACATGG - Intergenic
1100038080 12:90278267-90278289 TAATATATGTAAAAAGGAAGTGG + Intergenic
1100778386 12:97997258-97997280 AAATGTATATGAAAAGTACTTGG + Intergenic
1104888620 12:132127376-132127398 AAATATATGTAAAAATTACAGGG - Intronic
1107029945 13:35840241-35840263 TAAAGTATGTACAAAGTAGGAGG + Intronic
1108783302 13:53864040-53864062 CATTTTATGTAAAAAGAATGAGG - Intergenic
1109451593 13:62521643-62521665 CAAGGTATGTACAAAATACAAGG + Intergenic
1110623518 13:77625520-77625542 TAATGCAGGTAAAAAGTACTAGG - Intronic
1111448777 13:88387197-88387219 CAATATATGTAAGATGTACAAGG + Intergenic
1111541133 13:89668575-89668597 CAATGTATGTAAGAAATATATGG + Intergenic
1111654706 13:91138046-91138068 GAATGAATGCAAAAAGTAGGTGG - Intergenic
1113128840 13:107011769-107011791 CAATGCCTGTGAAAAGTACTTGG + Intergenic
1115153562 14:30313402-30313424 CTATGTATCTAAAAAGTGCTTGG + Intergenic
1118832448 14:69447096-69447118 CAATGAATGTTAAATGTAGGGGG + Intronic
1119119873 14:72065036-72065058 CAATGTATGTGAAAACACCGCGG - Intronic
1119193288 14:72699086-72699108 CAATGGATGTTATAAGTATGGGG + Intronic
1127000288 15:54495866-54495888 CAAAGTATATAAGAAGTAAGGGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128997503 15:72307494-72307516 CAATGTATGTAAAGTGTCCCAGG - Intronic
1134785853 16:16942644-16942666 CAATATATGTAAGATGAACGTGG + Intergenic
1142053825 16:87979206-87979228 CAATGTATGTAACACGTCTGAGG + Intronic
1145032836 17:19518260-19518282 CTATGTTTGTAAGAAGTACAAGG - Intronic
1146119030 17:30173292-30173314 AAATGTATGTAAAAAGCACTTGG - Intronic
1156901047 18:42300454-42300476 CCATTTATGCAAAAGGTACGGGG - Intergenic
1157371950 18:47121857-47121879 AAATCTATGTGAAAAGTATGGGG - Intronic
1158407666 18:57174560-57174582 CTGTGTTTGAAAAAAGTACGGGG + Intergenic
1158688924 18:59642985-59643007 AAATGTATGTCAAAAGTAGAGGG + Intronic
1159988260 18:74871592-74871614 CAAAGTATTTAAAAATTATGTGG - Intronic
1160700613 19:505206-505228 CAATGTATGTAAAAAGTACGTGG - Exonic
1161693144 19:5749180-5749202 CAAAGTAGGTAAAAAGAAAGTGG + Exonic
1164848388 19:31456233-31456255 CAATGTATGAAAAAAGTTACAGG + Intergenic
926636355 2:15184106-15184128 CTATGTATGTAAAATGTAAATGG + Intronic
930796534 2:55398153-55398175 AAATCTATGAAATAAGTACGTGG + Intronic
931503440 2:62897127-62897149 GTATGTGTGTAAAAACTACGAGG - Intronic
938106983 2:128538877-128538899 GAATGTATATGAAAAGTAGGAGG + Intergenic
939012990 2:136869191-136869213 TAATGTATTTATAAAGTAGGTGG + Intronic
939395259 2:141621126-141621148 CAATGTATGTAAAACATATGAGG - Intronic
939808096 2:146799308-146799330 CAATGTATGTCAAAATTACTTGG - Intergenic
940220377 2:151345296-151345318 CAATGGATGTAAAGAGTAAGAGG - Intergenic
940278305 2:151962429-151962451 CAGTATTTGTAAAAGGTACGAGG - Intronic
943534325 2:189128258-189128280 TTATGTTTGTAAAAAGTAGGTGG + Intronic
944134582 2:196384693-196384715 GAATGAATGTAAAAAATACTAGG - Intronic
1169665531 20:8031320-8031342 CAAAATATGTAAAAAGCACAAGG + Intergenic
1170402316 20:16001188-16001210 CACAGTATGTAAAAAGCAGGTGG + Intronic
1170559851 20:17547604-17547626 CAATGTTTGTAAAAAGAAATTGG + Intronic
1177484833 21:21744120-21744142 CAAAGTACATAAAAAGTACTAGG - Intergenic
1177942525 21:27428917-27428939 GAATGAATGTGAAAAGTAAGGGG - Intergenic
1182453898 22:30437544-30437566 CAATGTGTGTAAAATGTACATGG + Intergenic
1182898786 22:33880776-33880798 ATATGTATGTCAAAAGTAAGAGG - Intronic
953899032 3:46828489-46828511 CAATGTGTGGAAAAAATATGTGG + Intergenic
954093289 3:48301830-48301852 CAGTATTTGTCAAAAGTACGCGG + Intergenic
957741698 3:84279336-84279358 CAATGTATATTAAAAATACCTGG + Intergenic
957845976 3:85736167-85736189 AAATGTATTTAAAAAGGAAGTGG + Intronic
963887560 3:150599077-150599099 CAATGTATGTAAAATTTATCAGG + Intronic
972981010 4:44701359-44701381 CAATCTATGTAAAAATTTTGGGG + Intronic
975697582 4:77028848-77028870 AAATGCATGTAGAAAGTACTTGG - Intronic
976410353 4:84706391-84706413 TAAAGTATGTACAAAGTACCAGG + Intronic
979363571 4:119793569-119793591 GAATGTCTGTAAACAGTACCAGG + Intergenic
980903139 4:138924038-138924060 CAATGTAAGAAAAAAGGAGGCGG + Intergenic
988289049 5:29261012-29261034 AAATGTATGAAAAAAGTATATGG + Intergenic
994100750 5:95889924-95889946 TAATGTATGTACCAAGTACCAGG + Intronic
995986466 5:118181436-118181458 CTATTTATTTAAAAAGTAAGAGG - Intergenic
996484146 5:124011627-124011649 TAATGCATGTAAAAAGTATTTGG - Intergenic
997019624 5:129983732-129983754 CAATGTATGCATAAAATATGAGG + Intronic
998022208 5:138779187-138779209 CAATGAATGTCAAAACTACTGGG - Intronic
1001092285 5:168750325-168750347 CAATGGATTTATAAAGTGCGTGG - Intronic
1005778491 6:29162865-29162887 CAAAGTATGTTAAAAGTAGAGGG - Intergenic
1005941555 6:30564095-30564117 CAATGGATTTAAAATGTACAGGG + Intergenic
1009004148 6:57761297-57761319 CAATGTATGTATATACTACAGGG + Intergenic
1011671055 6:89683430-89683452 CATTGTATATAAAAGGTACAGGG - Intronic
1014869646 6:126577073-126577095 CAATTCATGTAATAAGTAGGAGG + Intergenic
1016373253 6:143395542-143395564 TATTGTATTTAAAAAGAACGTGG - Intergenic
1018630621 6:165818973-165818995 CAATGTATATAAAATGTAAGGGG + Intronic
1021311483 7:19103333-19103355 CAACCTACGTAAAAAGTATGTGG - Intronic
1023019195 7:35995136-35995158 CAATGTATTTAAACAGCATGAGG + Intergenic
1024367876 7:48543890-48543912 CAATATATATAAAAAATACTTGG + Intronic
1024523936 7:50332297-50332319 AAATGTATGTATAAAGGAGGAGG - Intronic
1024803317 7:53106735-53106757 CAATGTATGTAAAAAGATTAGGG + Intergenic
1028876603 7:95830591-95830613 CAATGTATATAAAAAGTGACTGG - Intronic
1036276812 8:7359772-7359794 CAATTTTTGAAAAAAGTACGTGG - Intronic
1038620427 8:29137667-29137689 CCTTTTATGTAAAAAGGACGAGG - Intronic
1038641002 8:29326972-29326994 CACAGTATGTAAAAAGTATGGGG - Intergenic
1039528611 8:38238997-38239019 GAATCTCTGTAAAAAGTATGTGG + Intronic
1039836907 8:41263858-41263880 AAATATATGTAAAAAGTGCGGGG + Exonic
1040758806 8:50812963-50812985 CAATCTATGTAAGAAAAACGAGG - Intergenic
1043362710 8:79494048-79494070 CAGTGTATGAAAAAGGTACTTGG - Intergenic
1044321548 8:90807685-90807707 AAATGTTTGCAAAAAGTATGAGG - Intronic
1046589900 8:116193462-116193484 CAATGTATGTAGAAAGAGCTGGG - Intergenic
1046836003 8:118801937-118801959 CAATGTCTCTTAAAAGCACGAGG + Intergenic
1047321032 8:123783261-123783283 AAATGTATATATAAAGTACTTGG + Intronic
1050491144 9:6189126-6189148 TAATGTATGTAAAAAGTACCTGG + Intergenic
1052432128 9:28380233-28380255 CAATGTGTCTAAAATGTACCTGG + Intronic
1052525934 9:29620195-29620217 TAATGTATGTGAAAAGTAGTAGG + Intergenic
1057281466 9:93715056-93715078 CAATGTTTGTAAAAGGTATGAGG + Intergenic
1059043767 9:110842386-110842408 CAAGGTATGTGACAAGTAGGGGG + Intergenic
1186528909 X:10275772-10275794 CAATATATTCAAAAAGTACATGG - Intergenic
1188207359 X:27377317-27377339 CAATGTGGATAAAAACTACGTGG + Intergenic
1190735641 X:53254455-53254477 CAATCTAGGTAAAAAGTAGCAGG + Intronic
1190760857 X:53436952-53436974 CTATGTATTTAAAAAGGACTTGG + Intergenic
1190820087 X:53965712-53965734 CAATCTTTGTAAAAAGTAGTTGG + Intronic
1190955800 X:55192265-55192287 CAATGTAAATAAAAAGTTTGAGG + Intronic
1192039777 X:67606634-67606656 CAGTGTACGTAAGAAGTACTTGG - Intronic
1192730134 X:73794778-73794800 CAATGTATTAAAAAAGCACTTGG - Intergenic
1194430800 X:93801898-93801920 CAAGGTATGTGAAAAGGAGGAGG - Intergenic
1198150947 X:133908795-133908817 CAGTTTATGTAAAAAGTTCTTGG - Intronic