ID: 1160700993

View in Genome Browser
Species Human (GRCh38)
Location 19:507345-507367
Sequence CAATAAGGACACAAGGAAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1356
Summary {0: 1, 1: 1, 2: 1, 3: 52, 4: 1301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160700987_1160700993 17 Left 1160700987 19:507305-507327 CCAATCAATATACACAAAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 213
Right 1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG 0: 1
1: 1
2: 1
3: 52
4: 1301
1160700985_1160700993 26 Left 1160700985 19:507296-507318 CCAGGAGAGCCAATCAATATACA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG 0: 1
1: 1
2: 1
3: 52
4: 1301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160700993 Original CRISPR CAATAAGGACACAAGGAAAG TGG Exonic
900039574 1:447145-447167 CAATGAGAACACATGGACAGAGG + Intergenic
900061005 1:682121-682143 CAATGAGAACACATGGACAGAGG + Intergenic
901234638 1:7661366-7661388 GAACAAGGACAGAAGGAGAGTGG - Intronic
902139557 1:14341472-14341494 CAAGTGGGACACAAGGACAGTGG - Intergenic
902747653 1:18483964-18483986 CAATAAGGAGAAAAGTAATGTGG - Exonic
904594416 1:31634116-31634138 CAGTAAGGACAGAGGGAAAAAGG + Intronic
905983043 1:42248947-42248969 CAATGAGGACACATGGACACAGG - Intronic
906087856 1:43151411-43151433 AAATAAGTAGACAAGTAAAGAGG + Intronic
906458009 1:46014369-46014391 CAATGAGGACACATGGACACAGG - Intronic
906856741 1:49314425-49314447 CAATAAGAACACATGGACACAGG - Intronic
906912308 1:49967460-49967482 CAATAAGAACACATGGACATAGG + Intronic
907132459 1:52108898-52108920 CAATGAGAACACATGGACAGGGG - Intergenic
907700252 1:56779412-56779434 CAAGAAGGAGCAAAGGAAAGAGG + Intronic
908082529 1:60596750-60596772 CAACAAGGATTCAAGCAAAGGGG - Intergenic
908283833 1:62571849-62571871 CAATAAGAACACATGGACACAGG + Intronic
908556048 1:65257061-65257083 CAATGAGAACACAAGGACACAGG - Intronic
909141033 1:71865548-71865570 CAATAAGAACACATGGACACAGG + Intronic
909323289 1:74317536-74317558 CAGTGAGGACACATGAAAAGAGG + Intronic
909427583 1:75545051-75545073 CAATGAGGACACATGGACACAGG - Intronic
909434095 1:75620026-75620048 CAATAAGAACACACGGACACGGG - Intergenic
909441719 1:75703458-75703480 CAATAAGAACACATGGACACAGG + Intergenic
909523768 1:76599487-76599509 CAATAAGAACACATGGACACGGG - Intronic
909624424 1:77699989-77700011 CAACAAGAACACAAGGACACAGG + Intronic
909867501 1:80692708-80692730 AAATAAGGAGAGAAGGAAATAGG - Intergenic
910056465 1:83038592-83038614 CAATGAGAACACAAGGACACAGG + Intergenic
910240700 1:85082886-85082908 CAAGAAGAGAACAAGGAAAGCGG - Intronic
910530984 1:88235272-88235294 CAATAAGAACACATGGACACAGG - Intergenic
910610814 1:89140237-89140259 CAATAAGAACACATGGACACAGG + Intronic
911158593 1:94660030-94660052 CAATAAGAACACATGGACACAGG + Intergenic
911290521 1:96051770-96051792 CAATGAGAACACAAGGACACAGG - Intergenic
911311795 1:96301850-96301872 CAATAAGAACACATGGACACAGG + Intergenic
911536751 1:99109001-99109023 CAATGAGAACACATGGACAGAGG + Intergenic
911664266 1:100536209-100536231 CAATAAGGACAAATGGCAATAGG + Intergenic
911836400 1:102624568-102624590 CAATGAGGACACATGGACACAGG - Intergenic
911852427 1:102836379-102836401 CAATGAGAACACATGGACAGAGG + Intergenic
912066403 1:105749219-105749241 CAATAAGAACACATGGACACAGG + Intergenic
912108502 1:106311386-106311408 CAATGAGAACACATGGACAGAGG - Intergenic
912591711 1:110827938-110827960 CAATAAGGTTACAAATAAAGTGG + Intergenic
912973862 1:114310308-114310330 CAATGAGGACACATGGACACAGG + Intergenic
913042042 1:115036515-115036537 AAATAAGAACTCAAGGAGAGAGG - Intergenic
913316172 1:117554613-117554635 CAATAAGAACACATGGACACAGG - Intergenic
913717163 1:121547804-121547826 CAATAAGAACACATGGACACAGG - Intergenic
914249727 1:145911915-145911937 CAAGAGAGACACAAAGAAAGAGG + Exonic
914366212 1:146981077-146981099 CAATGAGAACACAAGGACACAGG + Intronic
914459835 1:147873208-147873230 CAATGAGAACACAAGGACACAGG - Intergenic
914849475 1:151303408-151303430 AAACAAGGACAGAATGAAAGAGG + Intronic
915003720 1:152617366-152617388 CAATGAGGACACATGGACACAGG + Intergenic
915044878 1:153003889-153003911 CAATGGGGAAACAAGGAAGGAGG - Intergenic
915046839 1:153024622-153024644 CAATGGGGAAACAAGGAAGGAGG - Intergenic
915060776 1:153182585-153182607 CAATGAGAACACATGGACAGAGG - Intergenic
915757554 1:158277345-158277367 CAATGAGGACACATGGACACAGG - Intergenic
916245721 1:162686411-162686433 CAATGAGGACACATGGACACAGG - Intronic
916377899 1:164176039-164176061 CAATAAGAACACATGGACACAGG - Intergenic
916512006 1:165480709-165480731 CAATGAGGACACATGGACACAGG - Intergenic
916543312 1:165778237-165778259 CAATGAGAACACATGGACAGGGG - Intronic
916804644 1:168247366-168247388 CAATGAGAACACATGGAAAAGGG - Exonic
916868137 1:168883435-168883457 CAATGAGAACACATGGACAGAGG - Intergenic
916878195 1:168992836-168992858 CAATAAGAACACATGGACACAGG - Intergenic
917061994 1:171051535-171051557 CAATGAGAACACATGGAAAAAGG + Intronic
917080766 1:171254853-171254875 CAATAAGAGCACAAAGAAAGAGG - Intronic
917275625 1:173328301-173328323 CAATAAGAACACATGGACACAGG + Intergenic
918441728 1:184574644-184574666 GAATAAGGGCAAAAGGAAACTGG + Intronic
918495651 1:185132856-185132878 GAAGAAGTAAACAAGGAAAGTGG + Intronic
918678597 1:187322571-187322593 CAATAAGAACACATGGACACAGG - Intergenic
918756108 1:188340732-188340754 CAATAAGAACACATGGACACAGG + Intergenic
918814242 1:189162470-189162492 CAATAAGAACACATGGACACAGG - Intergenic
918856355 1:189760738-189760760 CAATAAGAACACATGGACACAGG + Intergenic
918888304 1:190227801-190227823 CTATAAGAATACAATGAAAGAGG + Intronic
918939403 1:190972328-190972350 CAATGAGAACACATGGACAGAGG + Intergenic
919042912 1:192414640-192414662 CAATGAGGACACATGGACACAGG + Intergenic
919171462 1:193959527-193959549 CAATGAGAACACAAGGACACAGG + Intergenic
919431821 1:197503408-197503430 CAATAATGGCAGAAGGCAAGGGG + Intergenic
919580612 1:199367390-199367412 CAATAAGAACACATGGACACAGG + Intergenic
919750440 1:201034506-201034528 CAACATGGACACAGGGGAAGGGG + Intergenic
919939039 1:202273853-202273875 CAACAAGGAGAGATGGAAAGGGG - Intronic
920110112 1:203581811-203581833 TAGTTAGGACACAGGGAAAGTGG - Intergenic
920203987 1:204278137-204278159 CATGAAGGACATTAGGAAAGGGG - Intronic
920732577 1:208501568-208501590 GCACAAGGACAGAAGGAAAGTGG - Intergenic
921171543 1:212554372-212554394 TAATTAGGACATAAGGAAACAGG - Intergenic
921275420 1:213514424-213514446 CAATGAGAACACATGGACAGAGG - Intergenic
921565188 1:216709012-216709034 CAATAAGAACACATGGACACAGG + Intronic
921753086 1:218819965-218819987 CAATAAGAACACATGGACACAGG - Intergenic
921835624 1:219775072-219775094 CAATGAGAACACATGGACAGAGG - Intronic
922357265 1:224788248-224788270 CAATAATGAAAGAAAGAAAGTGG + Intergenic
922378716 1:224997926-224997948 CAATGAGAACACATGGACAGAGG + Intronic
922448141 1:225714932-225714954 TAATAAGGACAGAAGGAAATTGG - Intergenic
922997538 1:229976448-229976470 AGATAGGGACACAGGGAAAGAGG + Intergenic
923048806 1:230375687-230375709 GAATAACCTCACAAGGAAAGAGG + Intronic
923417164 1:233774646-233774668 CAATAAAAACACTAAGAAAGTGG - Intergenic
923423005 1:233838533-233838555 CAATAAGAACACATGGACACGGG + Intergenic
923654506 1:235904133-235904155 CAATAAGAACACAGGGACACAGG + Intergenic
923708006 1:236360941-236360963 CATTAAGGACACAAGGAAAGAGG + Intronic
923871869 1:238003987-238004009 CAATGAGAACACAAGGACACAGG + Intergenic
923931154 1:238698720-238698742 CAATGAGAATACAAGGACAGAGG - Intergenic
924024993 1:239822768-239822790 GAATAATGAGACATGGAAAGGGG + Intronic
924202341 1:241673134-241673156 CAATGAGGACACATGGACACAGG + Intronic
924285988 1:242487008-242487030 CAATAAGAACACATGGACACCGG + Intronic
924509366 1:244716217-244716239 CAATAAGAACACATGGACACAGG + Intergenic
924632941 1:245759506-245759528 AAATAGGGACACAACCAAAGAGG + Intronic
924761886 1:246995029-246995051 CAACAAGTACACAGGGAACGGGG + Intronic
924911661 1:248520221-248520243 CAATAAGAACACATGGACACAGG + Intergenic
924955279 1:248920340-248920362 CAATAAGAACACATGGACATAGG - Intergenic
1063528221 10:6804340-6804362 CAATAAGAACACATGGACACAGG - Intergenic
1063603786 10:7505768-7505790 CAAGAAGAAAAAAAGGAAAGGGG - Intergenic
1063748557 10:8915216-8915238 CAATGAGGACACATGGACACAGG - Intergenic
1063753984 10:8985037-8985059 CAATAAGAACACATGGACACAGG + Intergenic
1063765392 10:9134290-9134312 CAATAAGAACACATGGACACAGG - Intergenic
1064356228 10:14620725-14620747 CAATAAGAACACATGGACACAGG - Intronic
1064518863 10:16179958-16179980 CAAAAGAGACACAAAGAAAGAGG - Intergenic
1064654753 10:17546095-17546117 CAATGAGGACACATGGACACAGG + Intergenic
1064797567 10:19030309-19030331 CAAGAGGTACACAAGGACAGTGG - Intergenic
1064883094 10:20079730-20079752 CAATAAGAACACATGGACACAGG + Intronic
1065256608 10:23875896-23875918 CAATGAGAACACATGGACAGAGG + Intronic
1065996894 10:31067944-31067966 CAATGAGAACACATGGAAACAGG + Intergenic
1066033628 10:31456204-31456226 CAATAAGAACACATGGACATAGG + Intronic
1066139941 10:32494589-32494611 CAATAAGAACACATGGACACAGG - Intronic
1066187031 10:33020031-33020053 CAATAAGAACACATGGACACAGG - Intergenic
1066283776 10:33944026-33944048 CAATAGGGAAACAGGGAGAGAGG + Intergenic
1066692389 10:38043294-38043316 CAATAAGAACACATGGACACAGG + Intronic
1066788157 10:39028903-39028925 CAATAAGAACACATGGACACAGG + Intergenic
1066816964 10:39430793-39430815 CAATAAGAACACATGGACACAGG + Intergenic
1067015361 10:42753906-42753928 CATCACGGACAGAAGGAAAGAGG + Intergenic
1067212737 10:44274253-44274275 CAATGAGAACACATGGACAGAGG + Intergenic
1067213092 10:44278155-44278177 CAATGAGGACACATGGACACAGG + Intergenic
1067262765 10:44708743-44708765 CCAGAAGGAGACAAGGAGAGTGG - Intergenic
1067266926 10:44754395-44754417 CAATAAGAACACATGGACACAGG - Intergenic
1067834399 10:49629167-49629189 CTATAAGGTCAGAAGGACAGGGG + Intronic
1068101319 10:52557370-52557392 AAATAGGGACCCAAGGAAAATGG + Intergenic
1068107335 10:52635091-52635113 CAATGAGAACACATGGACAGAGG - Intergenic
1068139713 10:52990745-52990767 CAATCAGGACAGAAGGCAAAAGG + Intergenic
1068255586 10:54505593-54505615 CAATGAGAACACATGGAAACAGG + Intronic
1068427707 10:56889031-56889053 CAATGAGAACACAAGGACACAGG - Intergenic
1068437030 10:57005741-57005763 CAATAAGAACACATGGACACAGG + Intergenic
1068893507 10:62173931-62173953 CAATAAGAACACATGGACACAGG + Intergenic
1068952160 10:62788586-62788608 CAATGAGGACACATGGACACAGG + Intergenic
1068954376 10:62808760-62808782 CTAGAAGGAGACAAGGAAAAGGG - Intergenic
1069004457 10:63301606-63301628 CAATGAGAACACAAGGACACAGG + Intronic
1069161027 10:65092636-65092658 CAATAAGAACACATGGACACAGG + Intergenic
1069232452 10:66028542-66028564 CAATGAGGACACATGGACACAGG + Intronic
1069300860 10:66905317-66905339 CAATAAGAACACATGGACACAGG + Intronic
1069387061 10:67893341-67893363 CAATAAGAACACATGGACACAGG - Intronic
1069522069 10:69130411-69130433 CAAGAAGGACACTAGCAAATTGG + Intronic
1069652837 10:70063296-70063318 CAATAAGGGCACATGCTAAGGGG + Intronic
1070087916 10:73254721-73254743 CAATAAGGGGAAAAGGAAAAAGG - Intronic
1070213907 10:74355787-74355809 CAACAAACACATAAGGAAAGAGG - Intronic
1070687634 10:78500990-78501012 CAATAAGAACACATGGACACAGG + Intergenic
1071431555 10:85610922-85610944 GAATGAGGACACATGGAGAGAGG - Intronic
1071512630 10:86273106-86273128 CAATGAGAACACATGGACAGAGG - Intronic
1071936580 10:90538255-90538277 CAATCAGGACAACAGGCAAGAGG + Intergenic
1071951340 10:90705974-90705996 CAATAAGAACACATGGACACAGG + Intergenic
1073737357 10:106364583-106364605 CAATATGGTCATAAAGAAAGGGG + Intergenic
1073853789 10:107652000-107652022 CATTAAGGAGAAAGGGAAAGTGG + Intergenic
1073885398 10:108033890-108033912 CAATGAGGACACATGGACACAGG + Intergenic
1074032646 10:109704116-109704138 CAATAAGAACACATGGACACAGG + Intergenic
1074034517 10:109724905-109724927 CAATGAGGACACATGGACACAGG + Intergenic
1074200440 10:111230013-111230035 CAATAAGAACACATGGACACAGG + Intergenic
1074618097 10:115091151-115091173 CAATGAGAACACATGGACAGAGG - Intergenic
1074661395 10:115661972-115661994 CAATGAGGACACATGGACACAGG - Intronic
1074718014 10:116237849-116237871 CAAAAAGGTCACAAGGAAGTGGG + Intronic
1074942567 10:118249321-118249343 CAAGAAAGAGACAAGGAAATTGG + Intergenic
1074964830 10:118481155-118481177 CAATAAGAACACATGGACACAGG + Intergenic
1075163770 10:120047717-120047739 CAATAAGAACACATGGACATAGG + Intergenic
1075226680 10:120635707-120635729 CATTAAGTATACAAAGAAAGAGG - Intergenic
1075909509 10:126112170-126112192 CAATAAGAACACATGGACACAGG + Intronic
1076019747 10:127062870-127062892 GAAGAAGGACAGAAGGACAGGGG - Intronic
1076089325 10:127667685-127667707 AAATAAGGACACAAGGAACAGGG + Intergenic
1076448583 10:130538091-130538113 CAATAAGAACACATGGACACAGG + Intergenic
1076965797 11:83057-83079 CAATGAGAACACATGGACAGAGG + Intergenic
1077402228 11:2364754-2364776 AAATGAGGACCCAAGGGAAGAGG + Intergenic
1077945032 11:6887772-6887794 CAATGAGGACACATGGACACAGG - Intergenic
1078191160 11:9093144-9093166 CATTAAGGACACAAAGACAAAGG - Intronic
1078617312 11:12878109-12878131 CAATAAAGAAAAAGGGAAAGGGG - Intronic
1078969513 11:16391139-16391161 CAATAAGAACACATGGACATGGG + Intronic
1078994581 11:16684527-16684549 CAATAAGAACACATGGACACAGG + Intronic
1079257385 11:18843806-18843828 CAATGAGAACACATGGACAGAGG + Intergenic
1079310693 11:19363175-19363197 CAATAAGAACACATGGACATAGG - Intronic
1079415287 11:20229198-20229220 CAATGAGAACACAAGGACACAGG - Intergenic
1079899706 11:26167188-26167210 AAAAATGGAGACAAGGAAAGAGG - Intergenic
1079914747 11:26354735-26354757 TACTGAGGAAACAAGGAAAGAGG - Intronic
1079965868 11:26979093-26979115 CAATAAGAACACATGGACACAGG - Intergenic
1080221042 11:29904761-29904783 CAATGAGGACACATGGACACAGG + Intergenic
1081043037 11:38235418-38235440 CAATAAGAACACATGGACACAGG + Intergenic
1081067658 11:38565844-38565866 CAATGAGAACACAAGGACACAGG - Intergenic
1081255184 11:40884108-40884130 CAATAAGAACACATGGACACAGG - Intronic
1081277782 11:41171548-41171570 CAATAAGAACACATGGACACAGG + Intronic
1081499654 11:43653594-43653616 CAATAAGAACACATGGACACAGG - Intronic
1082134116 11:48528115-48528137 CAATGAGAACACAAGGACACAGG - Intergenic
1082272643 11:50188651-50188673 CAATAAGAACACATGGACACAGG + Intergenic
1082612836 11:55322688-55322710 CAATAAGAACACATGGACACAGG + Intergenic
1082627062 11:55498776-55498798 CAATAAGAACACATGGAAACAGG - Intergenic
1082776383 11:57248069-57248091 CAATGAGGACACATGGACAGAGG + Intergenic
1082878189 11:58010039-58010061 CAATAAGAACACAGGGACACAGG - Intergenic
1082939020 11:58684436-58684458 CAATGAGAACACATGGAAACAGG + Intronic
1083067333 11:59938756-59938778 GAATAAGATCAAAAGGAAAGGGG - Intergenic
1083502847 11:63127172-63127194 CAATGAGAACACATGGAAACAGG - Intronic
1083511758 11:63215379-63215401 CAATGAGGACACATGGACACAGG + Intronic
1083728432 11:64640506-64640528 CCAGAAGGAGACAATGAAAGGGG + Intronic
1085452509 11:76643482-76643504 CAATGAGAACACAAGGACACAGG - Intergenic
1085709472 11:78816019-78816041 CAATCAGGACACAGAAAAAGTGG - Intronic
1085906989 11:80775343-80775365 CAATAATGGCAGAAGGCAAGGGG - Intergenic
1086153490 11:83639554-83639576 CAATGAGAACACATGGACAGAGG + Intronic
1086234874 11:84617178-84617200 CAATAAGAACACATGGACACAGG - Intronic
1087052601 11:93901466-93901488 CAATGAGGACACATGGACACAGG + Intergenic
1087331581 11:96787691-96787713 CAATGAGAACACATGGACAGAGG - Intergenic
1087343476 11:96938419-96938441 CAATAAGAACACATGGACACAGG - Intergenic
1087435893 11:98117016-98117038 CAATGAGAACACATGGAAACAGG - Intergenic
1087462589 11:98463722-98463744 CAATGAGGACACATGGACACAGG + Intergenic
1087919875 11:103854431-103854453 CAATAAGAACACATGGACACAGG - Intergenic
1087967933 11:104441203-104441225 CAATGAGAACACAAGGACACAGG + Intergenic
1088122592 11:106387541-106387563 CAATAAGAACACATGGACACAGG - Intergenic
1088160624 11:106865597-106865619 CAATAAGAACACATGGACACAGG + Intronic
1088405430 11:109470925-109470947 CAATGAGAACACATGGAAACAGG + Intergenic
1088517463 11:110653999-110654021 CAATAAGAACACATGGACACAGG + Intronic
1088526967 11:110766911-110766933 CAATAAGAACACATGGACACAGG - Intergenic
1088527954 11:110776863-110776885 CAATGAGAACACATGGAAATGGG + Intergenic
1088531619 11:110816797-110816819 AAATAAGGAGAGAAAGAAAGAGG + Intergenic
1088594936 11:111434348-111434370 CAATAAGAACACATGGACACAGG + Intronic
1088702230 11:112423566-112423588 CAAAAAGCACACAAGGCATGGGG - Intergenic
1088988256 11:114928818-114928840 CAAAAAGGAGACAATGAAAAAGG + Intergenic
1089039962 11:115438222-115438244 CAAGCAGAACACAAGCAAAGTGG - Intronic
1089186526 11:116619279-116619301 CAATAAGAACACATGGACACAGG - Intergenic
1089196769 11:116698109-116698131 CAATAATTAATCAAGGAAAGAGG - Intergenic
1089284896 11:117399177-117399199 CAATGAGAACACATGGAAACAGG - Intronic
1090527882 11:127557011-127557033 CAATGAGAACACATGGAAACAGG + Intergenic
1090537148 11:127655564-127655586 GAATTAGGACAATAGGAAAGAGG + Intergenic
1090554837 11:127862975-127862997 CAATAAGAACACATGGACACAGG - Intergenic
1090562000 11:127942619-127942641 CAATGAGAACACAAGGACACAGG + Intergenic
1090705905 11:129336384-129336406 CAATAATAACACAAAAAAAGAGG - Intergenic
1092297749 12:7214513-7214535 CAATAAGAACACATGGACACAGG + Intronic
1092328069 12:7555126-7555148 CAATGAGAACACATGGACAGAGG + Intergenic
1092332670 12:7600128-7600150 CAATAAGAACACAAGGACATAGG + Intergenic
1092650673 12:10631515-10631537 CAAGAAGGACCCCAGGAAATCGG + Intronic
1092746328 12:11675819-11675841 CAAAAAGGAAGGAAGGAAAGAGG + Intronic
1093394509 12:18664954-18664976 CAATGAGGACACATGGACACAGG + Intergenic
1093569610 12:20651962-20651984 CAATGAGAACACATGGACAGAGG - Intronic
1093599835 12:21008620-21008642 CAATGAGAACACATGGACAGTGG + Intergenic
1094055373 12:26263939-26263961 CAATGAGAACACATGGGAAGGGG + Intronic
1094060537 12:26310559-26310581 CAATAAGAACACATGGACACAGG - Intergenic
1094089031 12:26627719-26627741 CAATAAGAACACATGGACACAGG + Intronic
1094139500 12:27166019-27166041 CAATAAGAACACATGGACACAGG - Intergenic
1094435866 12:30420051-30420073 CAATGAGGACACATGGACACAGG + Intergenic
1094722474 12:33078339-33078361 CAATAAGAACACATGGACACAGG - Intergenic
1095069505 12:37823567-37823589 CAATGAGAACACATGGACAGAGG - Intergenic
1095346690 12:41158400-41158422 CAATGAGAACACATGGACAGAGG - Intergenic
1095439050 12:42224571-42224593 CAATAAGAACACATGGACACAGG - Intronic
1095671309 12:44863138-44863160 CAATAAGAACACATGGACACAGG - Intronic
1095690612 12:45084305-45084327 CAATGAGAACACATGGACAGAGG - Intergenic
1095815111 12:46412846-46412868 CAATAATGACTCAAGTTAAGGGG + Intergenic
1095867477 12:46988440-46988462 CAATGAGAACACATGGACAGAGG + Intergenic
1095868365 12:46997748-46997770 CAATGAGGACACATGGACACAGG + Intergenic
1096357678 12:50955472-50955494 CAAAATGAACACAAGGAAACAGG - Intronic
1096778868 12:53980534-53980556 AAAGAAGGAAACAAGGAAATGGG + Intergenic
1096903177 12:54906315-54906337 CAATGAGAACACATGGATAGAGG + Intergenic
1096957062 12:55536943-55536965 CAATAAGAACACATGGACACAGG + Intergenic
1097356204 12:58605006-58605028 CAATAAGAACACATGGACACAGG + Intronic
1098044237 12:66383472-66383494 GAATAAGTACACATGGTAAGAGG - Intronic
1098112166 12:67134276-67134298 CAATGAGGACACATGGACACAGG + Intergenic
1098183856 12:67876382-67876404 CAATCATGACACAAGGCAAAGGG - Intergenic
1098469713 12:70829209-70829231 AAAGAAGGAAAGAAGGAAAGAGG + Intronic
1098534170 12:71576035-71576057 CAATAAGAACACATGGACACAGG + Intronic
1098834986 12:75413142-75413164 CAATAAGAACACATGGACACAGG + Intronic
1098979289 12:76937615-76937637 CAATAAGAACACATGGACACAGG - Intergenic
1099129662 12:78811439-78811461 CAATAAGAACACATGGACACAGG + Intergenic
1099135960 12:78901983-78902005 CAATAAGAACACATGGACACAGG + Intronic
1099217167 12:79867266-79867288 CAATAAGAACACATGGACACAGG + Intronic
1099258614 12:80347336-80347358 CAATAAGAACACATGGACACAGG - Intronic
1099305765 12:80953802-80953824 CAATAAGAACACATGGACACAGG + Intronic
1099312720 12:81048061-81048083 CAATGAGGACACATGGACAAAGG - Intronic
1099431431 12:82591109-82591131 CAATAAGAACACATGGACACAGG + Intergenic
1099575025 12:84368131-84368153 CAATGAGGACACATGGACACAGG + Intergenic
1099664084 12:85604275-85604297 CAATAATGGCACAAAAAAAGAGG - Intergenic
1099715430 12:86287550-86287572 CAATAAGAACACATGGACACAGG - Intronic
1099779651 12:87177353-87177375 CAATGAGGACACTTGGACAGAGG + Intergenic
1099886968 12:88543305-88543327 CAATGAGAACACAAGGACACAGG - Intronic
1099892157 12:88602997-88603019 CAATAAGAACACATGGACACAGG - Intergenic
1100071654 12:90727604-90727626 CAATGAGGACACATGGACACAGG - Intergenic
1100152001 12:91749980-91750002 CAATGAGAACACATGGACAGAGG - Intergenic
1100687357 12:97001761-97001783 CAATGAGAACACAAGGACACAGG - Intergenic
1100764828 12:97852270-97852292 CAATAAGAACACATGGACACAGG + Intergenic
1101072494 12:101090545-101090567 CAATAAGAACACATGGACACAGG + Intronic
1101274594 12:103185504-103185526 AAAGAAGGAAAGAAGGAAAGAGG - Intergenic
1101362350 12:104040094-104040116 CAATAAGAACACTAGGACATAGG + Intronic
1101442333 12:104713052-104713074 CAGTAAGGACATAGGGAAAATGG + Intronic
1101532807 12:105589930-105589952 CAACTAGGACACAATGACAGTGG + Intergenic
1102568225 12:113811156-113811178 CAATGAGGACACATGGACACAGG - Intergenic
1102668210 12:114594847-114594869 CAATAAGAACACATGGACACGGG + Intergenic
1104507160 12:129343373-129343395 CAATGAGAACACATGGACAGAGG + Intronic
1105657082 13:22453331-22453353 CAATATGGACACATGGATATTGG - Intergenic
1105818235 13:24056486-24056508 CACTTAGGACAGAAGGACAGAGG - Intronic
1105925877 13:25007451-25007473 CAATGAGAACACAAGGACACAGG - Intergenic
1105946330 13:25192918-25192940 AAATAAAGACAAAAGGAAAGAGG - Intergenic
1106110999 13:26776813-26776835 CCATAAGGACACATGGACACAGG - Intergenic
1106822936 13:33486602-33486624 CAATAAGGAAAGATGGAAAGAGG - Intergenic
1107232260 13:38124094-38124116 CAATAAGCACACATGGACACAGG - Intergenic
1107262642 13:38513572-38513594 CAATAAGGGCACAAAGGATGTGG - Intergenic
1107436133 13:40382343-40382365 CAAAAAGGACAGGAGGAAACGGG - Intergenic
1107673425 13:42770248-42770270 CATGAAGGACACAGGGAAAGTGG - Intergenic
1107952525 13:45476838-45476860 GAAAGAGGAGACAAGGAAAGTGG - Intronic
1108013654 13:46050173-46050195 TAATAAAGACACAACAAAAGAGG + Intronic
1108069183 13:46610012-46610034 CAAAAAGGAGAAAAAGAAAGTGG - Intronic
1108608016 13:52059751-52059773 CAATAAGAACACATGGACACAGG + Intronic
1108858617 13:54826311-54826333 CAATAAGAACACATGGACACAGG + Intergenic
1108929271 13:55795180-55795202 CAATGAGAACACATGGAAACAGG - Intergenic
1109175226 13:59147162-59147184 CAATGAGAACACATGGAAACAGG + Intergenic
1109178688 13:59187192-59187214 AAATAAGGACTCCAGGAAAGAGG + Intergenic
1109387922 13:61656867-61656889 CAATGAGAACACATGGAAACAGG - Intergenic
1109683130 13:65779029-65779051 CAATGAGGACACATGGACACAGG - Intergenic
1109981719 13:69916537-69916559 CAATGAGAACACATGGACAGAGG + Intronic
1110150058 13:72240430-72240452 CAATTAAGAGACAAGAAAAGAGG + Intergenic
1110156559 13:72323768-72323790 CAATAAGAACACATGGACACAGG + Intergenic
1110200505 13:72844531-72844553 CAATGAGAACACATGGAAACAGG - Intronic
1110200573 13:72845183-72845205 CAATGAGAACACACGGAAACAGG - Intronic
1110387966 13:74936801-74936823 CAATGAGAACACAAGGACACAGG + Intergenic
1110628422 13:77677887-77677909 CAATAAGAACACATGGACACAGG + Intergenic
1110715951 13:78704410-78704432 CAATGAGAACACATGGAAACAGG + Intergenic
1110872412 13:80467957-80467979 CAATGAGAACACATGGACAGAGG + Intergenic
1110878395 13:80539410-80539432 CAATAAGAACACATGGACACAGG - Intergenic
1111257892 13:85696576-85696598 CAATGAGAACACATGGACAGAGG - Intergenic
1111272989 13:85911984-85912006 CAATAAGAACACATGGACACAGG - Intergenic
1111312488 13:86507770-86507792 CAATAAGAACACATGGACACAGG - Intergenic
1111501834 13:89131337-89131359 CAATGAGAACACATGGAAACAGG + Intergenic
1111814863 13:93139543-93139565 CAATAAGAACACATGGACATAGG - Intergenic
1112078664 13:95941240-95941262 CAATAATGACATAAGTAAATTGG - Intronic
1112096998 13:96144841-96144863 CAATAAGAACACATGGACACAGG - Intronic
1112145399 13:96694208-96694230 TAATGAGAACACAAGGACAGGGG - Intronic
1112365840 13:98754772-98754794 CAATAAGAACACATGGACACAGG + Intergenic
1112667248 13:101589862-101589884 CATTAAGTACACAGGAAAAGAGG + Intronic
1112762452 13:102706501-102706523 CAATGAGGACACATGGACACGGG - Intergenic
1112850663 13:103702098-103702120 CAATAAGAACACATGGACACAGG - Intergenic
1112874205 13:104015255-104015277 CAATATTGACACAGGGAAAGCGG + Intergenic
1112978214 13:105347568-105347590 CAATGAGGACACATGGACACAGG + Intergenic
1112997035 13:105586816-105586838 CAATGAGAACACAAGGACACAGG + Intergenic
1113012726 13:105788659-105788681 CAATGAGGACACATGGACACAGG - Intergenic
1114109721 14:19465358-19465380 CATAAAGCACACAAGGAAAGAGG + Intergenic
1114422064 14:22592526-22592548 CTATTAGGAAACAAGGAGAGGGG - Intergenic
1114569917 14:23659646-23659668 CAATGAGAACACAAGGACACAGG + Intergenic
1114576032 14:23714600-23714622 CAATGAGAACACAAGGACACAGG + Intergenic
1114609655 14:24030513-24030535 CAATGAGAACACAAGGACACAGG + Intergenic
1114762066 14:25327087-25327109 CAATAAGAACACATGGACACAGG - Intergenic
1114874249 14:26696113-26696135 CAATGAGAACACATGGACAGAGG + Intergenic
1114921830 14:27342339-27342361 CAATAAGAACACATGGACACAGG + Intergenic
1115065545 14:29256108-29256130 CAATAATGGCAGAAGGAAAAGGG + Intergenic
1115317280 14:32037949-32037971 CAAAAGGGACAAAAGCAAAGAGG + Intergenic
1115700134 14:35945099-35945121 CAATCTGGACAAAAGGAATGTGG + Intergenic
1115727381 14:36231990-36232012 CAATGAGAACACATGGAGAGAGG - Intergenic
1115728639 14:36244208-36244230 CAATAAGAACACATGGACACAGG + Intergenic
1115893480 14:38058766-38058788 CAATGAGAACACATGGAAACAGG + Intergenic
1115928307 14:38462260-38462282 CAATAAGAACACATGGACACAGG - Intergenic
1116251849 14:42495416-42495438 CAAAAAAGACACAAGGAAACTGG - Intergenic
1116394240 14:44429239-44429261 CAATAAGAACACATGGACACAGG - Intergenic
1116509272 14:45723632-45723654 CAATGAGAACACAAGGATACAGG + Intergenic
1116614147 14:47112441-47112463 CAATAAGGACCCATGGACACAGG - Intronic
1116730293 14:48612630-48612652 CAATAAGAACACATGGATACAGG + Intergenic
1117007550 14:51437179-51437201 CAATGAGAACACATGGAAACAGG - Intergenic
1117105086 14:52390093-52390115 CAATGAGAACACATGGAAACAGG + Intergenic
1117614622 14:57520767-57520789 CAATAAGAACACATGGACACAGG - Intergenic
1118138035 14:63049297-63049319 GAAGAAGGAAAAAAGGAAAGGGG + Intronic
1118613537 14:67559856-67559878 CAACCAAGACAAAAGGAAAGGGG - Intronic
1118928475 14:70216361-70216383 CAATGAGAACACAAGGACACAGG + Intergenic
1118958962 14:70510751-70510773 CAATAAGAACACATGGACACAGG + Intergenic
1120061425 14:79987879-79987901 CAATAAGGTCAAAAGGCAATAGG - Intergenic
1120120925 14:80679681-80679703 CAATAAAGTCACAAGGCAAAGGG - Intronic
1120149717 14:81019653-81019675 CAATAAGAACACATGGACACAGG - Intronic
1120256557 14:82127237-82127259 CAAAAAGGATACAGGGAAACTGG - Intergenic
1120351783 14:83369970-83369992 CAATGAGAACACAAGGACACGGG - Intergenic
1120402457 14:84049183-84049205 CAATAAGAACACATGGACACAGG - Intergenic
1120590107 14:86364635-86364657 CAAGAAGGAGAGAAGGAAAAAGG + Intergenic
1120670265 14:87354934-87354956 CAATGAGAACACACGGAAACAGG - Intergenic
1120725285 14:87932260-87932282 CAATGAGAACACAAGGACACAGG + Intronic
1120936762 14:89904171-89904193 CAATGAGAACACATGGACAGAGG - Intronic
1121056526 14:90859908-90859930 CAATGAGAACACATGGAAACAGG + Exonic
1121810575 14:96884747-96884769 AAATAAGGACCTAAGGAAAATGG - Intronic
1121923852 14:97909717-97909739 CAATAAGAACACATGGACACAGG - Intergenic
1121940012 14:98061570-98061592 CAATAAGAACACACGGACACAGG + Intergenic
1122654120 14:103245726-103245748 CAATAAGAACACAAGGACACAGG - Intergenic
1123162938 14:106297289-106297311 CAATGAGAACACAAGGACACAGG - Intergenic
1123874726 15:24612419-24612441 AACCAAGGACACAAGGAAACAGG + Intergenic
1124000513 15:25755581-25755603 CAACCAGGACACTAGAAAAGGGG + Intronic
1124050025 15:26188466-26188488 CAATGAGGACACATGGACACAGG + Intergenic
1124119900 15:26880200-26880222 CAATAAGCCCTCAAGAAAAGTGG - Intronic
1124406144 15:29393673-29393695 CAATAAAAACACCAGGAATGGGG - Intronic
1124474236 15:30018095-30018117 CAATGAGAACACATGGACAGAGG - Intergenic
1125414349 15:39436943-39436965 CAATGAGAACACATGGACAGAGG - Intergenic
1126525913 15:49654049-49654071 AAAAAAGGAGACAAGGAAACAGG - Exonic
1126722545 15:51596868-51596890 CAATAAGAACACATGGACACAGG + Intronic
1127017470 15:54704759-54704781 CAATAAGAACACATGGACACAGG + Intergenic
1127744575 15:61953433-61953455 CAATGAGGACACATGGACACAGG - Intronic
1128193804 15:65731907-65731929 CATTGAGGACAGAAGAAAAGAGG - Intronic
1128836036 15:70809894-70809916 CAGTAAAGACACAGGGAAATGGG - Intergenic
1128920847 15:71608849-71608871 CAATATGTAGATAAGGAAAGTGG + Intronic
1129351814 15:74959646-74959668 TAGTGAGGACACAGGGAAAGGGG + Intronic
1129494404 15:75964227-75964249 AAATAAACACAGAAGGAAAGGGG + Intronic
1129496270 15:75984584-75984606 CAATAAGAACACACGGACACAGG + Intronic
1130435871 15:83899000-83899022 AACTATGGACACAATGAAAGTGG - Intronic
1130631435 15:85572863-85572885 CAATAAGAACACATGGACACAGG - Intronic
1131339113 15:91579700-91579722 CAATAAGAACACATGGACACAGG - Intergenic
1131495077 15:92901246-92901268 AAATAAGGACAAAAGCCAAGAGG + Exonic
1131681954 15:94732770-94732792 CAATAAACACACAAATAAAGGGG - Intergenic
1132254507 15:100364259-100364281 CAATGAGAACACATGGAAACAGG + Intergenic
1132693589 16:1192469-1192491 CAATGGGGACAGAAGGGAAGGGG - Intronic
1133082293 16:3332023-3332045 CAATGAGAACACAAGGACACAGG + Intergenic
1133157532 16:3885591-3885613 CAATGAGAACACAAGGACACAGG - Intergenic
1133414148 16:5593288-5593310 CAATAAGAACACATGGACACGGG + Intergenic
1133492354 16:6282580-6282602 CAATAAGAACACACGGACACAGG - Intronic
1133656904 16:7873688-7873710 CAATGAGAACACATGGACAGAGG - Intergenic
1133692645 16:8231316-8231338 CAATAAGAACACATGGTCAGAGG - Intergenic
1133741054 16:8651811-8651833 CAATGAGAACACAAGGACATAGG + Intergenic
1134556178 16:15167390-15167412 CAATAAGAACACATGGACACAGG + Intergenic
1134764559 16:16745235-16745257 CAATAAGAACACATGGACACAGG - Intergenic
1134786310 16:16946876-16946898 CAATAAGAACACATGGACACAGG - Intergenic
1134875772 16:17697374-17697396 CAATGAGAACACATGGAAACAGG - Intergenic
1134876944 16:17708831-17708853 CAATAAGAACACATGGACACAGG - Intergenic
1134916761 16:18079125-18079147 CAATAAGAACACATGGACACAGG + Intergenic
1135212431 16:20534967-20534989 CAATGAGGACACATGGACACAGG + Intergenic
1135461852 16:22651308-22651330 CAATAAGAACACATGGACACAGG - Intergenic
1136411154 16:30078025-30078047 CAATCAGGACTGAGGGAAAGGGG - Intronic
1136602722 16:31306215-31306237 TCATTAGGACACAAGGAAAAAGG - Intronic
1136772369 16:32852467-32852489 CAATGAGAACACAAGGACACAGG + Intergenic
1136898245 16:34009050-34009072 CAATGAGAACACAAGGACACAGG - Intergenic
1137020265 16:35418307-35418329 CAATAAGAACACATGGACACAGG + Intergenic
1137304817 16:47188560-47188582 CAATGAGAACACATGGACAGAGG + Intronic
1137324624 16:47421872-47421894 CAATGAGAACACATGGACAGGGG - Intronic
1137406225 16:48191776-48191798 CAATGAGAACACAAGGACACAGG + Intronic
1138612397 16:58136426-58136448 CAATAAGGACACCAAATAAGAGG - Intergenic
1138751718 16:59430611-59430633 CAATAAGAACACATGGACACAGG + Intergenic
1138753883 16:59458526-59458548 CAATAAGGACACAGACAATGAGG + Intergenic
1138795047 16:59957642-59957664 CAATAAGAACACATGGACACAGG - Intergenic
1138802492 16:60050396-60050418 CAATAAGAACACATGGACACAGG - Intergenic
1138949871 16:61899172-61899194 CAATAAGAACACATGGACACAGG - Intronic
1139222074 16:65193778-65193800 CAATGAGAACACATGGAAACAGG - Intergenic
1140027163 16:71301230-71301252 TAACAAGTACACAAGGAAAGAGG - Intergenic
1140316941 16:73907660-73907682 CGATATGGACAAAATGAAAGTGG + Intergenic
1140527853 16:75638429-75638451 CAATAAGAACACATGGACACAGG - Intronic
1140573356 16:76134886-76134908 CAATAAGAACACATGGACACAGG - Intergenic
1140874430 16:79137777-79137799 CATTAAGGATACAAGGAAGAAGG - Intronic
1140944618 16:79756417-79756439 CAATAAGGACAAAAGAAAGAAGG + Intergenic
1141052748 16:80786867-80786889 CAATAAGAACACATGAAAACAGG + Intronic
1141193038 16:81838556-81838578 CAATGAGAACACATGGACAGAGG + Intronic
1141253115 16:82376741-82376763 CAATAAGAACACATGGACACAGG - Intergenic
1141316805 16:82970122-82970144 CGATAAGAACACAAGGAAACAGG - Intronic
1141570839 16:84932762-84932784 CAGGAAGGACACCAGGAGAGTGG + Intergenic
1203074792 16_KI270728v1_random:1114565-1114587 CAATGAGAACACAAGGACACAGG + Intergenic
1142532761 17:594106-594128 CAATGAGAACACAAGGACACAGG + Intronic
1142644416 17:1302737-1302759 CAATCAGTAAACGAGGAAAGGGG + Intergenic
1142892886 17:2956740-2956762 CAAAAAGGAGAAAAGGGAAGCGG - Intronic
1143055150 17:4156845-4156867 CACTAAGGATAGACGGAAAGAGG - Exonic
1143211810 17:5193621-5193643 CAATGAGAACACATGGATAGAGG + Intergenic
1143825439 17:9602318-9602340 CAATGAGGACACATGGACACAGG - Intronic
1144150392 17:12437599-12437621 CAAAAATGAAACAAGGGAAGTGG - Intergenic
1144194373 17:12876145-12876167 GACTTAGGACACATGGAAAGAGG - Intronic
1144228418 17:13174375-13174397 CAATAAGAACACATGGACACAGG - Intergenic
1144340128 17:14303401-14303423 CATTAAGGACAAAGGGGAAGGGG - Intronic
1144525464 17:15985885-15985907 AAATAAAAACACCAGGAAAGAGG + Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1145238448 17:21225406-21225428 CAATGAGGACACATGGACACAGG + Intergenic
1145375997 17:22349474-22349496 CAACAATGACAAAAGGAAACAGG - Intergenic
1145687871 17:26694028-26694050 CAATGAGAACACACGGACAGAGG + Intergenic
1145869166 17:28259339-28259361 CAATGAGAACACAAGGACACAGG - Intergenic
1146608372 17:34282970-34282992 CAATGAGTACACATGGAAACAGG + Intergenic
1147311199 17:39596997-39597019 AAGGAAGGACACAAGGGAAGAGG - Intergenic
1147653248 17:42073765-42073787 CAAGAAAGAGCCAAGGAAAGCGG + Intergenic
1148830389 17:50426884-50426906 CACTGAGGACAGAAGGAAATAGG - Intronic
1148957787 17:51367881-51367903 CAATAAGAACACATGGACACAGG - Intergenic
1149020301 17:51955774-51955796 CAATGAGAACACATGGACAGAGG + Intronic
1149263246 17:54901083-54901105 CAAGAAGGAAACGACGAAAGGGG - Intronic
1150042776 17:61881252-61881274 CCATCAGCCCACAAGGAAAGAGG + Intronic
1150728328 17:67669649-67669671 CAATTTGTACACAAGGTAAGTGG + Exonic
1150928160 17:69555825-69555847 CAATGAGAACACAAGGACACAGG - Intergenic
1150974241 17:70066051-70066073 AAATAAGAACCCAAGGAAAAGGG - Intronic
1151030343 17:70730540-70730562 CAATGAGAACACAAGGACACAGG - Intergenic
1153270407 18:3315376-3315398 CAATAAGAACACATGGACATGGG - Intergenic
1153418907 18:4882279-4882301 CAATAAGAACACATGGACACAGG - Intergenic
1153603014 18:6800656-6800678 CAATAAGAACACATGGACAGAGG + Intronic
1153776272 18:8456744-8456766 CAATGAGAACACATGGACAGAGG - Intergenic
1153778448 18:8473983-8474005 CAATAAGGACAGAAGGAAGTGGG - Intergenic
1153859397 18:9185724-9185746 GAGTAAAGAGACAAGGAAAGAGG + Intronic
1154185714 18:12180983-12181005 CAATAAGAACACATGGACACAGG - Intergenic
1155255320 18:23992198-23992220 AAATAAGGACTCAATGAATGGGG + Intergenic
1155351086 18:24907018-24907040 CAATAAGAACACATGGACACAGG + Intergenic
1155385459 18:25272709-25272731 CAATGAGGACACAGGGATACAGG + Intronic
1155432715 18:25777730-25777752 CAATGAGAACACATGGAAACAGG + Intergenic
1155558835 18:27052869-27052891 CAATGAGAACACAAGGACACAGG + Intronic
1155681420 18:28491443-28491465 CAATAAGAACACATGGACACTGG + Intergenic
1155761120 18:29568439-29568461 CAATGAGAACACATGGACAGAGG + Intergenic
1156057811 18:33031676-33031698 CAATATTAACACAAAGAAAGAGG - Intronic
1156374639 18:36502442-36502464 CAATGAGAACACATGGACAGAGG - Intronic
1156437345 18:37146815-37146837 CAATAATGTCACAAAGAATGGGG - Intronic
1156438623 18:37161113-37161135 GAAAAAAGACACTAGGAAAGAGG - Intronic
1156588683 18:38461405-38461427 CAATCAGAACACTAGGAAAGAGG + Intergenic
1156663073 18:39371338-39371360 CAATGAGAACACATGGACAGAGG + Intergenic
1156820511 18:41366746-41366768 CTAGAAGGACACAAAGAAAGAGG - Intergenic
1156978809 18:43260763-43260785 CAATGAGGACACATGGACACAGG - Intergenic
1157050719 18:44161006-44161028 CAATGAGGACACACGGACACAGG - Intergenic
1157675495 18:49565603-49565625 CAAGCAGCCCACAAGGAAAGGGG - Intronic
1157684607 18:49632099-49632121 CAGTAAGGACCCATGGCAAGAGG - Intergenic
1157719547 18:49913487-49913509 CACTGAGGACACAGAGAAAGTGG - Intronic
1157795180 18:50567283-50567305 CAATGAGAACACAAGGACACAGG - Intronic
1158040454 18:53086795-53086817 CAATAAGAACACATGGACACAGG - Intronic
1158053773 18:53255409-53255431 CAATGAGGACACATGGACACAGG - Intronic
1158180245 18:54707275-54707297 CAATGAGGACACATGGACACAGG - Intergenic
1158680239 18:59560396-59560418 CAATAAGAACACACGGACACAGG + Intronic
1158764500 18:60432805-60432827 CAATGAGAACACATGGAAACAGG + Intergenic
1158913156 18:62088744-62088766 CACAAAGGATACAAGGAAAAAGG + Exonic
1158985843 18:62815736-62815758 CAGTACAGACACAAAGAAAGTGG + Intronic
1158989758 18:62856350-62856372 CAATGAGGTCAGAAGGTAAGGGG - Intronic
1159233522 18:65640181-65640203 CAATAAGGAGAAAAGAAAATAGG - Intergenic
1159281551 18:66292310-66292332 CAATGAGAACACAAGGACACAGG - Intergenic
1159315050 18:66762047-66762069 GAATAAAGATATAAGGAAAGAGG + Intergenic
1159395971 18:67856226-67856248 CAATAAGAACACATGGACACAGG + Intergenic
1159542020 18:69790213-69790235 CAATAAGAACACATGGACACAGG + Intronic
1159808358 18:72983417-72983439 CAAGAAGGACAAAAGAACAGGGG + Intergenic
1160192440 18:76725099-76725121 CAATGAGAACACAAGGACACAGG + Intergenic
1160275580 18:77430768-77430790 CAATAAGAACACATGGACACAGG + Intergenic
1160543134 18:79636189-79636211 CAATAAGAACACATGGACACAGG - Intergenic
1160642601 19:152687-152709 CAATGAGAACACATGGACAGAGG + Intergenic
1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG + Exonic
1161021066 19:2011776-2011798 CAATATGAACACAAGGACACAGG + Intronic
1161045177 19:2130748-2130770 CAGGAAGGCCACAAGGGAAGAGG - Intronic
1162310115 19:9901181-9901203 AAAGAAGGAAAGAAGGAAAGAGG + Intronic
1163941263 19:20496393-20496415 CAATGAGGACACATGGACATAGG + Intergenic
1164091616 19:21958029-21958051 CAATAAGAACACATGGACACAGG - Intronic
1164163207 19:22644422-22644444 CAATGAGAACACAAGGACACAGG - Intronic
1164390645 19:27817280-27817302 CAATAAGAACACATGGACACTGG - Intergenic
1165906472 19:39197373-39197395 AGATAAGGAAACAGGGAAAGAGG - Intronic
1166069592 19:40379345-40379367 CCAGAAGGACAGCAGGAAAGGGG - Exonic
1166531334 19:43545304-43545326 GAATAAGAACAAAAGGAAATGGG - Intronic
1166556447 19:43703209-43703231 CAAAAAGGAAAGAAGGGAAGAGG - Intergenic
1167320136 19:48792435-48792457 CAATGAGAACACAAGGACACGGG - Intergenic
1167968530 19:53169727-53169749 CAATAAGAACACATGGACACAGG - Intronic
1168183193 19:54677630-54677652 CAATAAGGACACACGTGGAGTGG - Intronic
1168440435 19:56361652-56361674 CAATGAGAACACATGGAAACAGG + Intronic
1168520952 19:57050174-57050196 CAATAAGAACACATGGACACAGG + Intergenic
924989516 2:300475-300497 CAATGAGAACACATGGACAGAGG + Intergenic
925303927 2:2836033-2836055 CAATAAGGACACAATGGCAAGGG + Intergenic
925407973 2:3619251-3619273 CAAGAAAGAAAAAAGGAAAGTGG - Intronic
925522357 2:4761511-4761533 CAATGAGAACACATGGACAGAGG + Intergenic
925566706 2:5262566-5262588 CAATGAGAACACATGGAAACAGG + Intergenic
925612104 2:5710196-5710218 AACTAAGGACTAAAGGAAAGGGG + Intergenic
925844117 2:8020403-8020425 CTACAAGGGCACCAGGAAAGTGG - Intergenic
926529909 2:14031590-14031612 CAATGAGAACACATGGAAACAGG - Intergenic
926933286 2:18062066-18062088 GTATAAGGACACAGGGAAAGAGG + Intronic
927044147 2:19260300-19260322 CAATGAGGACACATGGACACAGG + Intergenic
927099926 2:19780332-19780354 CAATAGGGAGATAAGGAAGGTGG - Intergenic
927310539 2:21625955-21625977 CAATGAGAACACAAGGACACAGG - Intergenic
928268038 2:29829112-29829134 CAATAAGAACACATGGACACAGG + Intronic
928463237 2:31495583-31495605 CAATAAGAACACATGGACACAGG + Intergenic
929360471 2:41082803-41082825 CAATAAGAACACATGGACACAGG + Intergenic
929765301 2:44839154-44839176 CAATAAGAACACATGGACACAGG - Intergenic
930496211 2:52147516-52147538 CAATAAGAACACAGGGACACAGG - Intergenic
930606945 2:53502555-53502577 CAATGAGGACACATGGACACAGG - Intergenic
931322474 2:61184689-61184711 CTATAAAGAAACAAGGGAAGTGG - Intronic
931385463 2:61794069-61794091 CAATAAGAACACATGGACACAGG - Intergenic
931462802 2:62462954-62462976 CCACAAGGTCACAAGGAAAGAGG - Intergenic
932696795 2:73963869-73963891 CAGTAGTCACACAAGGAAAGGGG + Intergenic
932944165 2:76207919-76207941 CAATAAGAACACATGGACACAGG - Intergenic
933023621 2:77225160-77225182 CAATAAGAACACATGGACACAGG + Intronic
933375642 2:81477011-81477033 CAATAAGAACACATGGACACAGG + Intergenic
933423202 2:82078184-82078206 AAATAAGGACAAAATAAAAGGGG - Intergenic
933534227 2:83552193-83552215 CAATAAGAACACATGGACACAGG - Intergenic
933802119 2:85969734-85969756 CAATTAGAACACATGGACAGAGG + Intergenic
934495836 2:94796961-94796983 CAATAAGAACACATGGACACAGG - Intergenic
934631853 2:95934551-95934573 CAATAAGAACACATGGACACAGG + Intronic
934704253 2:96465392-96465414 CAATAAGAACACATGGATACAGG - Intergenic
935517061 2:104052950-104052972 CATTAATGACAGAAGGAAACTGG + Intergenic
935845008 2:107156097-107156119 CAATGAGAACACATGGAAAGGGG + Intergenic
935894973 2:107726149-107726171 CAATGAGAACACAAGGACACAGG + Intergenic
935917144 2:107967373-107967395 CAATGAGGACACATGGACACAGG - Intergenic
936009186 2:108914305-108914327 AAATAAGAACACAAGAAAGGAGG + Intronic
936580749 2:113698558-113698580 CAATAAGAACACATGGACACAGG + Intergenic
936687684 2:114847393-114847415 CAATTAGGGCACAAGGAAGAAGG - Intronic
936772859 2:115935980-115936002 CAATAAGAACACATGGACACAGG - Intergenic
936888644 2:117342831-117342853 CAATAAGAACACATGGACACAGG + Intergenic
936897764 2:117447048-117447070 CAATAAGAACACATGGACACAGG - Intergenic
937576577 2:123429762-123429784 CAATGAGAACACAAGGACACAGG - Intergenic
937734242 2:125270642-125270664 CAATAAGAACACATGGACACAGG + Intergenic
937795668 2:126015841-126015863 CAATAAGAACACATGGACACAGG - Intergenic
938706888 2:133939332-133939354 CGATAAGGACACATGGACACAGG + Intergenic
939066028 2:137484214-137484236 CAATAAGAACACATGGACACAGG - Intronic
939304842 2:140398276-140398298 AAATAAAAACCCAAGGAAAGGGG + Intronic
939381520 2:141442623-141442645 CAATGAGAACACAAGGACACAGG - Intronic
939470902 2:142618121-142618143 CAATGAGGACACATGGACACAGG + Intergenic
939474942 2:142674951-142674973 CAATAAGAACACATGGACACAGG + Intergenic
940069672 2:149671709-149671731 CAATAAGAACACATGGACATAGG - Intergenic
940142862 2:150513378-150513400 CAACCAGGACAGAGGGAAAGAGG + Intronic
940298564 2:152155542-152155564 CAACAAGGAGACAGGGTAAGTGG + Intronic
940557748 2:155252775-155252797 CAATAAGAACACATGGACACAGG - Intergenic
941335542 2:164239889-164239911 CAATCATGACATAAGGCAAGGGG + Intergenic
941612827 2:167682671-167682693 AAAGAAGGACACTAGGACAGAGG - Intergenic
941718794 2:168791186-168791208 CAATGAGAACACATGGACAGAGG - Intronic
942084181 2:172428470-172428492 CATGCAGGACACATGGAAAGTGG - Intronic
942203957 2:173600714-173600736 CAATGAGGACACATGGACACAGG - Intergenic
942353218 2:175076991-175077013 CAATAAGAACACATGGACATAGG - Intronic
942371631 2:175292069-175292091 CAGTAAGAAATCAAGGAAAGTGG - Intergenic
942761450 2:179403477-179403499 CAATGAGAACACATGGAAACAGG + Intergenic
943147161 2:184060321-184060343 CAATAAGAACACATGGACACAGG - Intergenic
943203643 2:184861470-184861492 AAATGAGTACAGAAGGAAAGAGG - Intronic
943305271 2:186253632-186253654 CAATGAGGACACATGGACACAGG + Intergenic
943628312 2:190223068-190223090 CAATAAGAACACATGGACACAGG + Intronic
943813585 2:192222296-192222318 CAATAAGAACACATGGACACAGG + Intergenic
943830486 2:192453973-192453995 CAATAAGAACACATGGACACAGG + Intergenic
943885372 2:193210090-193210112 CAATAAGAACACATGGACACAGG - Intergenic
943897633 2:193386237-193386259 CAATGAGAACACATGGAAACAGG + Intergenic
944063880 2:195598777-195598799 CATTACGGAAACAAGGAAACAGG + Intronic
944077612 2:195749779-195749801 CAATGAGGACACATGGACACAGG + Intronic
944253706 2:197603020-197603042 CAATAAGAACACATGGACATAGG + Intronic
944918098 2:204381629-204381651 CAATAAGAACACATGGACACAGG - Intergenic
945371667 2:209026084-209026106 CAATGAGGACACATGGATACAGG + Intergenic
945431031 2:209766006-209766028 CAATGAGAACACACGGAAACAGG + Intergenic
945441435 2:209884844-209884866 CAATGAGAACACATGGAAACAGG + Intronic
945532566 2:210974269-210974291 CAATGAGAACACATGGACAGAGG - Intergenic
945627881 2:212234176-212234198 CAATAAGAACACATGGACACAGG - Intronic
945647748 2:212521202-212521224 CAATAAGGATGAAAGGACAGAGG + Intronic
945830994 2:214784823-214784845 CAATGAGAACACATGGACAGAGG + Intronic
946032365 2:216715444-216715466 AAATAATGACAGAAAGAAAGGGG - Intergenic
946059481 2:216929393-216929415 CAATGAGAACACAAGGACACAGG - Intergenic
946551471 2:220806163-220806185 CATTCAGGGCACAAGGTAAGAGG - Intergenic
946674433 2:222143764-222143786 AAATAAAGACACAAGTAAATTGG + Intergenic
946990965 2:225329009-225329031 CAATCACGACACAAGGCAAAGGG + Intergenic
947211958 2:227716811-227716833 CAATAATGACTGAAGGAAATTGG + Intronic
947381357 2:229548539-229548561 CAATGAGGACACATGGACACAGG + Intronic
947459232 2:230288663-230288685 CAATAAGGACACATGGACACAGG - Intronic
947622864 2:231602206-231602228 AAAAAAGGGCACAAGGACAGAGG + Intergenic
948238827 2:236411843-236411865 CAATGAGAACACATGGACAGAGG + Intronic
948241212 2:236437135-236437157 CAATGAGAACACATGGACAGAGG - Intronic
948495684 2:238347293-238347315 CAATAGGGACATTAGAAAAGCGG + Intronic
1168732500 20:97823-97845 CAATAAGAACACATGGACACAGG - Intergenic
1169261104 20:4138639-4138661 CAATAAGAACACATGGACACAGG - Intronic
1169349397 20:4855992-4856014 GAATAGGGATGCAAGGAAAGAGG + Exonic
1169575196 20:6952062-6952084 CAAAATACACACAAGGAAAGAGG + Intergenic
1169814239 20:9640255-9640277 CAATAAGAACACATGGACACAGG - Intronic
1170051867 20:12155101-12155123 GAACAAGGACACAAGGACACAGG - Intergenic
1170215543 20:13886994-13887016 CCAAAAAGACTCAAGGAAAGGGG + Intronic
1170518711 20:17160690-17160712 CAATAAGAACACATGGACATAGG + Intergenic
1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG + Intronic
1170718531 20:18853886-18853908 CAAAAAGCATACAAAGAAAGAGG - Intergenic
1170766600 20:19294476-19294498 CAATGAGAACACATGGAAACGGG - Intronic
1171131516 20:22658072-22658094 CAATAAGTAAACAAGGAGGGAGG - Intergenic
1171775104 20:29358678-29358700 CAATGAGGACACATGGACACAGG + Intergenic
1171775791 20:29366251-29366273 CAATAAGAACACATGGACACAGG - Intergenic
1171817120 20:29796292-29796314 CAATGAGGACACATGGACACAGG + Intergenic
1171901234 20:30859704-30859726 CAATGAGGACACATGGACACAGG - Intergenic
1171903124 20:30875288-30875310 CAATGAGAACACAAGGACACAGG - Intergenic
1172154293 20:32812868-32812890 CAAAAAGGAAAGAAAGAAAGGGG - Intergenic
1172242983 20:33425665-33425687 CAAAAAGGAAAGAAAGAAAGTGG + Intronic
1172787807 20:37480644-37480666 AAAGAAGGAAAGAAGGAAAGAGG - Intergenic
1173086344 20:39922547-39922569 CAATGAGAACACATGGAAACAGG + Intergenic
1173340837 20:42151345-42151367 CAATGAGGACACATGGACACGGG - Intronic
1173399984 20:42716983-42717005 CAATAAGAACACATGGACACAGG + Intronic
1173927199 20:46789651-46789673 CCATAAGGTCAGAAGGGAAGTGG - Intergenic
1174999575 20:55612130-55612152 CAATAAGAACACATGGACACAGG - Intergenic
1175021136 20:55850992-55851014 CAATGAGAACACATGGAAACAGG + Intergenic
1175026775 20:55910840-55910862 CAATGAGGACACATGGACACAGG + Intergenic
1175042212 20:56064261-56064283 CAATGAGGACACATGGACACAGG + Intergenic
1175164985 20:57036990-57037012 CAATAAGTACACATGGACACAGG - Intergenic
1175652938 20:60743936-60743958 CAATAAGAACACATGGACACAGG + Intergenic
1176349391 21:5779861-5779883 CAATAAGAACACATGGACACTGG + Intergenic
1176356205 21:5900445-5900467 CAATAAGAACACATGGACACTGG + Intergenic
1176543712 21:8177931-8177953 CAATAAGAACACATGGACACTGG + Intergenic
1176562663 21:8360976-8360998 CAATAAGAACACATGGACACTGG + Intergenic
1176904498 21:14483356-14483378 TAAAAAGGACACAAGAATAGCGG - Intergenic
1176975568 21:15316899-15316921 CAATGAGAACACATGGAAACAGG - Intergenic
1177085906 21:16703586-16703608 CAATGAGAACACATGGACAGAGG - Intergenic
1177104452 21:16937246-16937268 CAATGAGAACACATGGAAACAGG - Intergenic
1177191684 21:17858967-17858989 CAATGAGAACACATGGACAGAGG + Intergenic
1177463455 21:21443223-21443245 CAATGAGAACACATGGACAGAGG + Intronic
1177579755 21:23006032-23006054 CAATAAGAACACATGGACACAGG + Intergenic
1177619571 21:23569962-23569984 CCAGAAAGACAGAAGGAAAGAGG - Intergenic
1177662547 21:24105068-24105090 CAATAAGAACACATGGACATGGG + Intergenic
1177928081 21:27244028-27244050 CAGTAAGAACACATGGAGAGTGG + Intergenic
1178034038 21:28560910-28560932 CAATGAGGACACATGGACACAGG + Intergenic
1178779754 21:35590631-35590653 CAATAAGAACACATGGACACAGG + Intronic
1178800876 21:35794343-35794365 CAATAAGAACACATGGACACAGG - Intronic
1179053390 21:37909064-37909086 CAACTAGCAGACAAGGAAAGAGG - Intronic
1179279838 21:39924999-39925021 CAATAGGCACACAGGGAAAGAGG - Intronic
1179320660 21:40287936-40287958 CAGAAAGGACACAGGAAAAGGGG + Intronic
1179492891 21:41752770-41752792 CAATGAGAACACATGGACAGAGG + Intronic
1179645457 21:42772569-42772591 GACAAAGGACAGAAGGAAAGAGG + Intronic
1180318043 22:11294202-11294224 CAATGAGAACACATGGAAAAAGG + Intergenic
1180320452 22:11315060-11315082 CAATGAGGACACATGGACACAGG + Intergenic
1180334599 22:11565657-11565679 CAATGAGGACACATGGACACAGG - Intergenic
1180520035 22:16189523-16189545 CAATGAGATCACAAGGAAACAGG + Intergenic
1180610634 22:17095435-17095457 CATGAAGACCACAAGGAAAGTGG - Intronic
1182403344 22:30101381-30101403 CAATGAGAACACATGGAAACAGG + Intronic
1183929046 22:41225699-41225721 CAATAGGGACACGAGGCAAATGG - Intronic
1203248580 22_KI270733v1_random:94153-94175 CAATAAGAACACATGGACACTGG + Intergenic
949150412 3:760146-760168 CAATGAGAACACAAGGACACAGG - Intergenic
949155523 3:822407-822429 CAATGAGAACACATGGAAACAGG + Intergenic
949250599 3:1979262-1979284 CAATGAGAACACATGGAAACAGG + Intergenic
949381270 3:3448282-3448304 CAATATGGACACTAGGTAGGGGG - Intergenic
949449846 3:4173826-4173848 CAATAAGAACACATGGACACAGG + Intronic
949455862 3:4237974-4237996 CAATGAGAACACATGGAAACAGG - Intronic
949889343 3:8721881-8721903 CAATAAGAACACATGGACACGGG + Intronic
950091009 3:10294423-10294445 AGAAGAGGACACAAGGAAAGGGG - Intronic
950618295 3:14180103-14180125 CAGTAAGTACACAAGGCCAGTGG - Intronic
950834642 3:15907434-15907456 CAATAAGAACACATGGACACAGG - Intergenic
951006417 3:17620780-17620802 CAATAAGGATGTAAAGAAAGGGG + Intronic
951424528 3:22528260-22528282 CAATGAGAACACATGGACAGAGG - Intergenic
951712188 3:25594446-25594468 GAATAAGGAAACAAGGAAGAGGG + Intronic
951858576 3:27225460-27225482 CAATAAGGATTAAAGAAAAGAGG - Intronic
951911420 3:27754280-27754302 CAATAAGAACACATGGACACAGG - Intergenic
951917382 3:27816170-27816192 CAATGAGGACACATGGACACAGG - Intergenic
952374966 3:32759342-32759364 CAATCTGGACACCAGGAAAGAGG - Intronic
952737688 3:36706605-36706627 CAATAATGGCAGAAGGCAAGGGG + Intergenic
952975559 3:38692271-38692293 CAATAAGAACACATGGACACAGG - Intergenic
953000491 3:38928319-38928341 CAATAAGAACACATGGACACAGG + Intronic
953015413 3:39070876-39070898 CAATAAGAACACATGGACACAGG - Intronic
953127588 3:40106600-40106622 AAATAAGAACAGAAGGAAAGTGG - Intronic
953342120 3:42143477-42143499 CATTGTGGAGACAAGGAAAGGGG - Intronic
953394553 3:42557152-42557174 CGACAAAGACACAAGGAAGGTGG + Intronic
953441436 3:42921756-42921778 CAATGAGAACACAAGGACACAGG - Intronic
953844245 3:46414694-46414716 CAATAAGAACACATGGACACAGG - Intergenic
954719740 3:52551235-52551257 CAGCAGGGACACAAGGGAAGAGG + Intronic
954846372 3:53561709-53561731 CAATAAGGGTTCAAAGAAAGTGG - Intronic
955050083 3:55401863-55401885 CAATGAGAACACATGGAAACAGG + Intergenic
955231873 3:57106728-57106750 CAATAAAAACACAATGAGAGAGG + Intronic
955388179 3:58496767-58496789 CAATGCGGACACACAGAAAGAGG - Intronic
955562725 3:60209881-60209903 CAATGAGAACACAAGGACACAGG + Intronic
955790129 3:62580383-62580405 CAATAAGAACACATGGACACAGG + Intronic
955854816 3:63261824-63261846 CAATGAGAACACAAGGACATAGG + Intronic
955901942 3:63765409-63765431 CAATGAGAACACACGGACAGAGG - Intergenic
955902399 3:63771077-63771099 CAATGAGGACACATGGACATAGG - Intergenic
956047464 3:65211042-65211064 CAATAAGAACACAAAGATGGTGG + Intergenic
956354078 3:68371420-68371442 CAATAAGAACACATGGACACAGG - Intronic
956718237 3:72097094-72097116 CAAGAAGGCCACAAGTGAAGAGG + Intergenic
957126936 3:76173556-76173578 CAATAAGAACACATGGACACAGG - Intronic
957150334 3:76478222-76478244 CAATAAGAACACATGGACACAGG - Intronic
957622204 3:82608112-82608134 CAATAAGAACACATGGACACAGG + Intergenic
957658371 3:83112389-83112411 CAATGAGAACACAAGGACACAGG + Intergenic
957756422 3:84494142-84494164 CAATAAGAACACATGGACACAGG + Intergenic
958093048 3:88902404-88902426 CAATGAGAACACATGGACAGAGG - Intergenic
958484089 3:94681022-94681044 CAAAGAGGACACAAAGAAAATGG + Intergenic
958511852 3:95059991-95060013 CAATGAGAACACATGGACAGAGG - Intergenic
958564166 3:95786452-95786474 CAATAAGAACACATGGACACAGG + Intergenic
958956713 3:100472570-100472592 CAATGAGAACACATGGACAGAGG - Intergenic
958961573 3:100515425-100515447 CAATGAGAACACATGGACAGAGG + Intronic
959203255 3:103274805-103274827 CAATAAGAACACATGGACACAGG - Intergenic
959217111 3:103465000-103465022 CAATGAGAACACATGGACAGAGG + Intergenic
959360854 3:105389780-105389802 CAATAAGAACACATGGACACAGG - Intronic
959505243 3:107150033-107150055 CAATAAGAACACATGGACACAGG + Intergenic
959639580 3:108617725-108617747 CAATGAGGAAACAAAGAAAATGG + Intronic
959839412 3:110957015-110957037 CAATAAGAGCAATAGGAAAGAGG + Intergenic
959876196 3:111385152-111385174 CAATAAGAACACATGGACACCGG + Intronic
960142334 3:114163086-114163108 GAATCAGGAGACAAGAAAAGAGG - Intronic
960177830 3:114537929-114537951 CAATAAGAACACATGGACATAGG + Intronic
960368751 3:116808420-116808442 CAATGAGAACACAAGGACACAGG + Intronic
960580366 3:119273182-119273204 CAATAAGAACACATGGACACAGG + Intergenic
960754699 3:120998576-120998598 CAATAAGAACACATGGACACAGG - Intronic
961334823 3:126167246-126167268 CAATAAGGAAAAAAGGAACCAGG + Intronic
962082203 3:132151696-132151718 CAATAAGAACACATGGACACAGG + Intronic
962122161 3:132573123-132573145 CAATAAGAACACATGGACATGGG - Intronic
962139103 3:132769573-132769595 CAAAATGGACACAAGCAAAGAGG - Intergenic
962613686 3:137103419-137103441 CAAAATGGACACCAGGAGAGTGG - Intergenic
962639419 3:137369356-137369378 CAATGAGAACACATGGACAGAGG - Intergenic
962665348 3:137648680-137648702 GAATAAGGAACCAAGGAATGGGG + Intergenic
962733805 3:138306349-138306371 AAAAGAGGACACAAGGACAGTGG + Intronic
962836199 3:139190839-139190861 CAATAAGAACACATGGACACAGG - Intronic
963211609 3:142699048-142699070 CAATGAGGACACATGGACACAGG + Intronic
963216810 3:142757595-142757617 CAATAAGAACACATGGACACAGG + Intronic
963333142 3:143938883-143938905 CAATGAGAACACATGGACAGAGG + Intergenic
963571357 3:147000851-147000873 CAATAAGAACACATGGACACAGG - Intergenic
963988518 3:151626214-151626236 CAATAAGAACACATGGACACAGG - Intergenic
964231096 3:154468932-154468954 CAATAAAGAAACAAGGAAGGAGG - Intergenic
964390742 3:156194979-156195001 CAATAAGAACACATGGACACAGG - Intronic
964486976 3:157196178-157196200 CAATAAGAACACATGGACACAGG + Intergenic
964936282 3:162092390-162092412 CAATAAGAACACATGGACACAGG - Intergenic
965158272 3:165094307-165094329 CAATGAGAACACATGGACAGAGG - Intergenic
965212600 3:165812923-165812945 CAATGAGGACACAGAGAAAGAGG - Intronic
965310733 3:167124834-167124856 CAATGAGAACACAAGGACAGAGG + Intergenic
965445066 3:168764644-168764666 CAATGAGAACACATGGAAACAGG - Intergenic
965516523 3:169627828-169627850 CAATTAGGAAATCAGGAAAGAGG + Intronic
965770610 3:172177894-172177916 CAATGAGAACACAAGGACACAGG - Intronic
966134305 3:176681141-176681163 CAATAAGAACACATGGACACAGG + Intergenic
966231731 3:177659555-177659577 CAATGAGGACACATGGACACAGG - Intergenic
966449684 3:180043629-180043651 CAATGAGAACACATGGACAGAGG + Intergenic
966573424 3:181473150-181473172 CAATAAGAACACATGGACATAGG - Intergenic
966581411 3:181569711-181569733 CTATAAGGCTACAAAGAAAGTGG - Intergenic
967116259 3:186341963-186341985 CAATGAGGACACATGGACACAGG + Intronic
967187154 3:186954025-186954047 CAATAAGAACACATGGACACAGG - Intronic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
967821018 3:193839087-193839109 CAATGAGAACACATGGACAGAGG + Intergenic
968218185 3:196912368-196912390 CAATAAGAACACATGGACATAGG + Intronic
969077033 4:4588124-4588146 CAATAAGAACACATGGACACAGG + Intergenic
969245461 4:5929553-5929575 ACAAAAGGACAGAAGGAAAGGGG + Intronic
969844806 4:9912087-9912109 CAATAAGAACACATGGACACAGG + Intronic
969977787 4:11122058-11122080 CAATAAGAACACATGGACACAGG - Intergenic
970072711 4:12179643-12179665 CAATGATGTAACAAGGAAAGTGG + Intergenic
970181842 4:13406195-13406217 CAATAAGAACACATGGACACAGG - Intronic
970239661 4:13995253-13995275 CAATATGGACAAAAGCACAGAGG - Intergenic
970277101 4:14413046-14413068 CAATAAGAACACACGGACACAGG + Intergenic
970820783 4:20210037-20210059 AAAAAAGGAAACAAGAAAAGGGG + Intergenic
971575744 4:28272043-28272065 CAACAAGAACACATGGACAGAGG + Intergenic
971865646 4:32167974-32167996 GAATAACGACAAAAGGAAATCGG - Intergenic
972091310 4:35288142-35288164 CAATGAGGACACATGGACACAGG - Intergenic
972405110 4:38738222-38738244 CAATGAGAACACATGGACAGAGG + Intergenic
972551097 4:40135142-40135164 CAATAAGAACACATGGACACAGG - Intronic
973071763 4:45868914-45868936 CAATGAGAACACATGGACAGAGG + Intergenic
973125089 4:46573057-46573079 CAATGAGAACACAAGGACACAGG + Intergenic
973640249 4:52895365-52895387 CAATGAGAACACAAGGACACAGG - Intronic
973983908 4:56331446-56331468 CAATGAGAACACAAGGACACAGG - Intergenic
974258289 4:59490526-59490548 CAATAAGGACAAAGGAAAAGAGG - Intergenic
974266101 4:59587828-59587850 CAATGAGAACACATGGACAGAGG + Intergenic
974720394 4:65730528-65730550 CAATAAGTACACATGGACACAGG + Intergenic
974822217 4:67081745-67081767 AAATAAGCACACTAGGAAAGAGG - Intergenic
974968521 4:68795826-68795848 CAATGAGGACACATGGACACAGG + Intergenic
975001850 4:69234231-69234253 CAATGAGGACACATGGACACAGG - Intergenic
975003592 4:69257860-69257882 CAATGAGGACACATGGACACAGG + Intergenic
975011952 4:69366474-69366496 CAATGAGGACACATGGACACAGG + Intronic
975203083 4:71614724-71614746 CATACAGGTCACAAGGAAAGTGG - Intergenic
975271813 4:72444060-72444082 CTATAATGGCACCAGGAAAGAGG + Intronic
975806922 4:78122170-78122192 CAATAAGAACACATGGACACAGG - Intronic
976079953 4:81345092-81345114 CAATAAGAACACATGGACACAGG + Intergenic
976100808 4:81561100-81561122 CAATAAGAACACATGGACACAGG - Intronic
976312401 4:83624861-83624883 CAATAAGGACGCAAAGAGATAGG + Intergenic
976924422 4:90479570-90479592 CAATGAGTACACATGGACAGAGG - Intronic
977131914 4:93250292-93250314 CAATGAGAACACAAGGACACAGG + Intronic
977342460 4:95776002-95776024 CAATAAGAACACATGGAAACAGG + Intergenic
977448416 4:97161981-97162003 CAATGAGAACACATGGACAGAGG + Intergenic
977469131 4:97420030-97420052 CAATGAGAACACAAGGACACAGG + Intronic
977677191 4:99760877-99760899 CAATGAGGACACATGGACACAGG - Intergenic
977752308 4:100624012-100624034 CAATGAGAACACAAGGACACAGG - Intronic
977776193 4:100922097-100922119 CAATAAGAACACATGGACACAGG + Intergenic
977887606 4:102271234-102271256 CAAGAAGGACACAAAGGAGGAGG + Intronic
978015684 4:103743253-103743275 CAATGAGAACACAAGGACACAGG + Intergenic
978036793 4:104004851-104004873 CAATGAGGACACATGGACACAGG + Intergenic
978064720 4:104382800-104382822 CAATAAGAACACATGGACACAGG + Intergenic
978236367 4:106465759-106465781 CAATGAGGACACATGGACATAGG - Intergenic
978554874 4:109969400-109969422 CAATGAGAACACATGGACAGAGG + Intronic
978931889 4:114324405-114324427 CACAAAGAACACAAGGAAAAGGG - Intergenic
979121090 4:116902685-116902707 CAACAAGGACAGAGGCAAAGTGG + Intergenic
979132920 4:117070967-117070989 CCATAAGAGCACAAGGAAACAGG - Intergenic
979141102 4:117175677-117175699 CAATGAGAACACAAGGACACAGG + Intergenic
979379170 4:119988123-119988145 CAATGAGAACACATGGAAAGAGG + Intergenic
979658464 4:123224404-123224426 CAATAAGAACACATGGACACAGG - Intronic
979791906 4:124794383-124794405 CAATAAGAACACATGGACACAGG + Intergenic
979830425 4:125293808-125293830 CAATGAGAACACATGGACAGAGG + Intergenic
979929163 4:126608870-126608892 GAATAAGGACAAGAGGAAAGTGG - Intergenic
980034240 4:127865471-127865493 CAATGAGAACACATGGACAGAGG + Intergenic
980176852 4:129356306-129356328 CAAGAAGGAAAAAAGGAAAGAGG - Intergenic
980307191 4:131076824-131076846 CAATGAGAACACATGGAAACAGG + Intergenic
980558223 4:134437334-134437356 CAATAAGAACACATGGACACAGG - Intergenic
980630274 4:135422559-135422581 CAATAAGAACACATGGACATGGG - Intergenic
980741545 4:136956264-136956286 CAATGAGAACACAAGGACACAGG + Intergenic
980834824 4:138178176-138178198 CAATGAGGACACATGGACACAGG - Intronic
980848483 4:138353159-138353181 CAATAAGAACACATGGACACAGG + Intergenic
981181541 4:141751471-141751493 CAATGAGAACACATGGACAGAGG - Intergenic
981285559 4:143014996-143015018 CAACAAGGACACAAGAAAAAAGG - Intergenic
981357378 4:143805238-143805260 CAATAAGAACACATGGACACAGG + Intergenic
981635014 4:146867194-146867216 CAACAAGGACAAGAGGAAATAGG - Intronic
981847064 4:149181777-149181799 CAATGAGAACACATGGACAGAGG + Intergenic
981880098 4:149600106-149600128 CAATAAATACACAAGTAAAAAGG - Intergenic
981988045 4:150881513-150881535 CAAGAAGGAGAGAAGGAAGGGGG + Intronic
982523829 4:156452962-156452984 AAATAAGGAAATAAAGAAAGAGG - Intergenic
982835981 4:160120409-160120431 CAATAAGAACACATGGACACAGG - Intergenic
983189708 4:164741900-164741922 CAATGAGAACACATGGACAGAGG + Intergenic
983402588 4:167284161-167284183 CAATGAGAACACAAGGACACAGG - Intergenic
983430047 4:167637815-167637837 CAATAATGATACAAGGGATGAGG - Intergenic
983457383 4:167982216-167982238 CAATAAGAACACATGGACACAGG - Intergenic
983608328 4:169615412-169615434 CAATGAGAACACAAGGACACAGG - Intronic
983623048 4:169780083-169780105 CAATGAGAACACATGGACAGAGG + Intergenic
983699613 4:170576109-170576131 CAATAAGAACACATGGACACAGG + Intergenic
983708389 4:170686363-170686385 CAATAAGGACACTTGGACACAGG - Intergenic
983948568 4:173613447-173613469 CAATAAGAACACTTGGAAACAGG - Intergenic
984424894 4:179570930-179570952 CAATAAGAACACATGGACACAGG + Intergenic
984680054 4:182597037-182597059 CAAAATGGACACAAGGAAAAAGG - Intronic
984914244 4:184706882-184706904 TAGTAAGGACACAGGGACAGAGG - Intronic
984953986 4:185027506-185027528 CAATAAGAACACATGGACACAGG + Intergenic
985325441 4:188763167-188763189 CAATAAGAACACATGGACACAGG - Intergenic
985766738 5:1784078-1784100 CAATGATGACACAAGGAATTTGG - Intergenic
986308757 5:6535738-6535760 TAATAAGTACCCAAGGGAAGGGG - Intergenic
986437006 5:7744168-7744190 CAATGAGGACACATGGACACAGG + Intronic
986518409 5:8587132-8587154 CAATAAGAACACATGGACACAGG - Intergenic
986784154 5:11096358-11096380 CAATGAGAACACATGGAAACAGG - Intronic
986816778 5:11421204-11421226 ATAAAAGGACAAAAGGAAAGTGG + Intronic
986834760 5:11623453-11623475 CAATCATGACACAAGGCAAAAGG - Intronic
987036040 5:14019372-14019394 CAATGAGAACACATGGAAACAGG + Intergenic
987556484 5:19457814-19457836 CAATGAGAACACAAGGACACAGG + Intergenic
987928741 5:24375624-24375646 CAATAAGAACACATGGACACAGG + Intergenic
987988025 5:25175308-25175330 CAATGAGGACACATGGACACAGG - Intergenic
988089224 5:26513889-26513911 CAATAAGAACACATGGACACAGG - Intergenic
988110955 5:26818702-26818724 CAATAAGAACACATGGACACAGG + Intergenic
988221102 5:28348278-28348300 CAATCATGACAGAAGGTAAGAGG + Intergenic
988518377 5:31924368-31924390 CATCATGGACAAAAGGAAAGTGG - Intronic
988608114 5:32699506-32699528 CAATAAGAACACATGGACACAGG - Intronic
988661966 5:33280362-33280384 CAATGAGAACACAAGGACACAGG + Intergenic
988999767 5:36748116-36748138 CAATAAGAACACATGGACACAGG + Intergenic
989083526 5:37651156-37651178 CAATGAGAACACATGGACAGAGG - Intronic
989502165 5:42180171-42180193 CAATAAGAACACATGGACACAGG + Intergenic
989763283 5:45047406-45047428 CAATAAGAACACATGGACACAGG - Intergenic
989795961 5:45472609-45472631 AAAGAAGGAAAGAAGGAAAGGGG + Intronic
989953111 5:50324350-50324372 CAATAAGAACACATGGACACAGG + Intergenic
989954095 5:50336023-50336045 CAATAAGAACACATGGACACAGG + Intergenic
989961394 5:50419976-50419998 CAATAAGAACACATGGACACAGG + Intronic
989975584 5:50582638-50582660 CAATGAGAACACATGGACAGTGG + Intergenic
990156934 5:52888206-52888228 AAATAAGGAAACATGAAAAGAGG + Intronic
990403349 5:55463131-55463153 CAATGAGAACACATGGACAGAGG + Intronic
990433304 5:55759831-55759853 GAACAAGGACACAGGGAAACAGG - Intronic
990708650 5:58558281-58558303 CATTAAGAACAAAAGAAAAGGGG - Intergenic
990924776 5:61008099-61008121 CAATGAGAACACATGGACAGAGG + Intronic
990940898 5:61201905-61201927 CAATAAGCACAAAAGAAAAGTGG + Intergenic
991040497 5:62170047-62170069 CAATAAGAACACATGGATACAGG + Intergenic
991172575 5:63645973-63645995 CAATAATGACAGAAGGCAAAGGG + Intergenic
991635160 5:68697448-68697470 CAATAAGAACACATGGACACAGG + Intergenic
991685708 5:69180532-69180554 CAATAACGACAAAAGGCAAAAGG - Intergenic
992023697 5:72650334-72650356 CAATGAGGACACATGGACACAGG - Intergenic
992148220 5:73874612-73874634 CAATAAGAACACATGGACACTGG - Intronic
992757007 5:79916895-79916917 CAATAAGAACACATGGATACAGG + Intergenic
993144358 5:84075146-84075168 CAATAAGAACACATGGACACAGG + Intronic
993283593 5:85960190-85960212 CAATAAGAACACATGGACACAGG - Intergenic
993350853 5:86848437-86848459 CAATAAGAACACATGGACACAGG + Intergenic
993387985 5:87282387-87282409 CACAAAGGACAGAAGAAAAGTGG - Intronic
993618240 5:90137897-90137919 CAATAAGAACACATGGACACAGG - Intergenic
993795258 5:92258746-92258768 CAATAAGAACACATGGACACAGG - Intergenic
993890658 5:93467851-93467873 CAATAAGAACACATGGACACAGG - Intergenic
993976700 5:94491646-94491668 CAATAATGCCTCAAGAAAAGGGG - Intronic
994028898 5:95117960-95117982 CAATGAGGACACACGGACACAGG + Intronic
994044589 5:95293670-95293692 TAATAAGGACACTGGGAAACTGG + Intergenic
994205656 5:97032794-97032816 CAATAAGGAGAAACGCAAAGGGG - Exonic
994298543 5:98119385-98119407 CAATGAGAACACATGGACAGAGG + Intergenic
994409440 5:99388199-99388221 CAAAAAGTAAAGAAGGAAAGAGG - Intergenic
994456331 5:100012924-100012946 CAATGAGAACACAAGGACACAGG + Intergenic
994551039 5:101235462-101235484 CAATAAGAACACATGGACACAGG - Intergenic
994645058 5:102458048-102458070 CAATAAGAACACATGGACACAGG + Intronic
994860995 5:105194117-105194139 CAATGAGGACACTTGGAAACAGG - Intergenic
995069203 5:107898664-107898686 CAATGAGAACACATGGAAACAGG - Intronic
995201389 5:109428666-109428688 CAATGAGGACACATGGACACAGG - Intergenic
995272771 5:110241404-110241426 CAATAAGAACACATGGACACAGG - Intergenic
995276034 5:110278859-110278881 CAATGAGGACACATGGACACAGG - Intergenic
995302355 5:110598808-110598830 CAATAAGAACACATGGACACAGG + Intronic
995785451 5:115822760-115822782 CAATAAGAACACATGGACACAGG - Intergenic
995966935 5:117918965-117918987 CAATGAGAACACAAGGACACAGG + Intergenic
996113260 5:119590576-119590598 CAACAAGGACATGTGGAAAGAGG + Intronic
996132069 5:119793854-119793876 CAATGAGGACACACGGACACAGG - Intergenic
996171906 5:120303807-120303829 CAATGAGGACACATGGACACAGG + Intergenic
996204971 5:120722067-120722089 CAATGAGAACACATGGAAACAGG - Intergenic
996232293 5:121081337-121081359 CAATAAGAACACATGGACACAGG - Intergenic
996276913 5:121678124-121678146 CAATAAGGACACTTGGACACAGG + Intergenic
996952727 5:129147371-129147393 CAATAAGAACACATGGACACAGG - Intergenic
997017448 5:129953173-129953195 CAATAAGAACACATGGACACAGG - Intronic
997425882 5:133802287-133802309 AACTAAGGAATCAAGGAAAGAGG + Intergenic
998251785 5:140558360-140558382 ACACAAGGACCCAAGGAAAGGGG + Exonic
998426604 5:142034197-142034219 CAATGAGGACACATGGACACAGG + Intergenic
998873118 5:146572622-146572644 CAATAAGAACACATGGATACAGG + Intergenic
998961934 5:147497197-147497219 CAATAAGAACACATGGACACAGG + Intronic
999033220 5:148317956-148317978 CAATGAGGACACATGGACACAGG - Intergenic
999476214 5:151901201-151901223 AAATAAGGACATAAGGAAGCAGG - Intronic
999544912 5:152617037-152617059 CAATGAGAACACATGGACAGAGG + Intergenic
999594827 5:153191478-153191500 CAATAAGAACACATGGACAAAGG + Intergenic
999604602 5:153300635-153300657 CAATGAGAACACATGGATAGGGG - Intergenic
999688956 5:154128770-154128792 CAATGAGAACACATGGACAGAGG + Intronic
999873297 5:155774370-155774392 CAACAAGGACAAAGGGAAAATGG - Intergenic
1000057790 5:157623394-157623416 CAATGAGGACACACGGACACAGG + Intergenic
1000155531 5:158547693-158547715 CAATAAGAACACATGGACACAGG - Intergenic
1000436658 5:161218984-161219006 CAATGAGGACAAAATGAATGGGG + Intergenic
1000449184 5:161363325-161363347 CAATGAGGACACATGGAGATAGG + Intronic
1000737789 5:164927344-164927366 CAATGAGAACACATGGAAACAGG - Intergenic
1000995512 5:167954660-167954682 CAATAAGAACACATGGACACAGG - Intronic
1001348299 5:170930604-170930626 CAATAAGAACACATGGACACAGG - Intronic
1001507838 5:172294275-172294297 CCATAAGGACTCAAGTACAGAGG + Intergenic
1001869488 5:175138787-175138809 CAATGAGAACACATGGACAGAGG + Intergenic
1001966973 5:175916935-175916957 CAATGAGGACACATGGACACAGG - Intergenic
1002249969 5:177922278-177922300 CAATGAGGACACATGGACACAGG + Intergenic
1002406378 5:179036459-179036481 CAATAATAACACTAGGAAAATGG + Intergenic
1002686542 5:181015980-181016002 CAATGAGAACACAAGGACATAGG + Intergenic
1002686719 5:181017763-181017785 CAATGAGAACACATGGACAGAGG + Intergenic
1002734273 5:181371798-181371820 CAATGAGAACACATGGACAGAGG - Intergenic
1002750267 6:102327-102349 CAATGAGAACACATGGACAGAGG + Intergenic
1003004954 6:2372504-2372526 CAATGAGGACACATGGACACAGG + Intergenic
1003403850 6:5812018-5812040 CAATAAGGGCTCAATGAATGTGG + Intergenic
1003417637 6:5926848-5926870 GAATTAAAACACAAGGAAAGGGG + Intergenic
1003642916 6:7890559-7890581 AAGTAAGGATACAAGGAATGGGG + Intronic
1003802631 6:9687585-9687607 CAATGAGAACACATGGACAGAGG + Intronic
1004004190 6:11623796-11623818 CAATGAGAACACAAGGACACAGG - Intergenic
1004097349 6:12570660-12570682 GAGTAAGTACACCAGGAAAGAGG + Intergenic
1004282156 6:14289466-14289488 CAATAAGAACACATGGACATAGG + Intergenic
1004691638 6:17997361-17997383 GAACAAGGACATAAGCAAAGGGG - Intergenic
1004782118 6:18920836-18920858 CAAGAAGGACACAAGGAGCAGGG - Intergenic
1005109321 6:22262113-22262135 CAATGAGAACACATGGACAGAGG - Intergenic
1005711730 6:28509740-28509762 CAATAAGGGCACAAAGAAAATGG + Intronic
1006261328 6:32873987-32874009 CAATGAGAACACAAGGACACAGG - Intergenic
1006373656 6:33659909-33659931 CAATGAGGGCACAGGGCAAGGGG - Intronic
1007027832 6:38596001-38596023 CAACAAGGAGACAAGCACAGAGG + Intronic
1007060613 6:38937151-38937173 CAATAAGAACACATGGACACAGG + Intronic
1007859320 6:44890927-44890949 CAATAAGAACACAAGGACACAGG + Intronic
1008040064 6:46788164-46788186 AAATAAGGGTACAAGGAAACAGG - Intergenic
1008134917 6:47763532-47763554 CAATAAGAACACATGGACACAGG - Intergenic
1008175647 6:48264965-48264987 CAATAAGAACACATGGACACAGG - Intergenic
1008286870 6:49663866-49663888 CAATAAGAACACATGGACACAGG - Intergenic
1008361620 6:50625790-50625812 CAATGAGAACACAAGGACACAGG + Intergenic
1008387318 6:50906727-50906749 CCATAAGAAAACAAGGAAAGGGG - Intergenic
1009247703 6:61260110-61260132 CAATAAGAACACATGGACATAGG - Intergenic
1009486850 6:64235283-64235305 CAATGAGGACACATGGACACAGG - Intronic
1009649569 6:66457155-66457177 CAATAAGAACACATGGACACAGG + Intergenic
1009742678 6:67767717-67767739 CAATAAGAACACATGGACACAGG + Intergenic
1009801030 6:68536601-68536623 CAATAAGAACACATGGACACAGG - Intergenic
1009881754 6:69575993-69576015 TAATAAGGGCTCTAGGAAAGAGG + Intergenic
1010035336 6:71319327-71319349 CAATAAGAACACATGGACACAGG + Intergenic
1010351793 6:74883476-74883498 CAATGAGAACACATGGACAGAGG - Intergenic
1010468234 6:76194095-76194117 CAATAAGAACACATGGACACAGG + Intergenic
1010596081 6:77765977-77765999 CAATAAGAACACATGGACACAGG + Intronic
1010629083 6:78175544-78175566 CATTGAGGACACATGGCAAGGGG - Intergenic
1010649908 6:78441628-78441650 GAAAAAGGACACAAGGAGAGAGG - Intergenic
1010700106 6:79034241-79034263 CAATAAAGGCACAATGAAACAGG + Intronic
1010731789 6:79398988-79399010 CAATAAGAACACATGGACACAGG + Intergenic
1010762629 6:79741240-79741262 CAATAAGAACACATGGACACAGG + Intergenic
1010771867 6:79841069-79841091 CAATGAGGAGGGAAGGAAAGTGG + Intergenic
1010854933 6:80825934-80825956 CAATGAGGACACATGGACACAGG + Intergenic
1011120907 6:83951478-83951500 CAATAAGAACACATGGACACAGG - Intronic
1011233164 6:85186882-85186904 CAGAAAAGACACAAGGGAAGAGG + Intergenic
1011317470 6:86052009-86052031 CAATAAGAACACATGGACACAGG - Intergenic
1011355069 6:86465574-86465596 CAATGAGGACACATGGACACAGG + Intergenic
1011523850 6:88241121-88241143 CAATGAGAACACATGGACAGAGG - Intergenic
1012048738 6:94312049-94312071 CAATGAGAACACATGGAAACAGG + Intergenic
1012204382 6:96442551-96442573 CAATAAGAACACATGGACACAGG + Intergenic
1012627700 6:101424363-101424385 CAATGAGAACACATGGACAGAGG - Intronic
1012653592 6:101788403-101788425 CAATGAGAACACATGGACAGAGG - Intronic
1012822369 6:104102338-104102360 CAATGAGGACACATGGACACAGG + Intergenic
1013302099 6:108813302-108813324 CAATAAGAACACATGGACACAGG - Intergenic
1014180662 6:118380965-118380987 CAATAAGAACACATGGACACAGG + Intergenic
1014288300 6:119528620-119528642 CAATAAAGAGACAGGGAGAGTGG - Intergenic
1014574157 6:123049746-123049768 CAATAAGAACACATGGACACAGG + Intronic
1014679156 6:124407389-124407411 CAATGAGAACACAAGGACACAGG - Intronic
1014839181 6:126197731-126197753 CAATAAGGACACAAATATGGAGG + Intergenic
1015406752 6:132846069-132846091 CAATAAGAACACATGGACACAGG - Intergenic
1015702673 6:136053252-136053274 CAATAAGAACACATGGACACAGG - Intronic
1015802621 6:137076096-137076118 CAATAAGTACACATGGACACAGG + Intergenic
1016165743 6:140940237-140940259 CAAAGAGTAGACAAGGAAAGTGG + Intergenic
1016185450 6:141192903-141192925 CAATCACGGCACAAGGCAAGTGG + Intergenic
1016412356 6:143796604-143796626 CAATAAGAACACATGGACACAGG - Intronic
1016735967 6:147480459-147480481 CAATAAGAACACATGGACACAGG - Intergenic
1016781639 6:147965734-147965756 CAATAAGAACACATGGACACAGG + Intergenic
1017284100 6:152654678-152654700 CAATAAGAACACATGGACACAGG + Intergenic
1017392282 6:153954208-153954230 CAATGAGAACACATGGAAACAGG - Intergenic
1017412041 6:154178086-154178108 CAATGAGGACACATGGACACAGG + Intronic
1017581429 6:155868692-155868714 CAATGAGGACACATGGACACAGG - Intergenic
1017956318 6:159180676-159180698 CAATAAGAACACATGGACACAGG - Intronic
1018116137 6:160587371-160587393 CAAATAAGGCACAAGGAAAGAGG - Intronic
1018116581 6:160591843-160591865 CAAATAAGACACAAGGAAAGGGG - Intronic
1018348396 6:162927599-162927621 CAATGAGAACACATGGAAATGGG + Intronic
1018464632 6:164032266-164032288 CAATAAGAACACATGGACACAGG - Intergenic
1018592440 6:165442337-165442359 CAATGAGGACACATGGACACAGG - Intronic
1019081430 6:169433284-169433306 CAATGAGAACACATGGAAACAGG - Intergenic
1019151736 6:170010968-170010990 GAATAAGGACAGAGGGAAGGAGG + Intergenic
1019238523 6:170644113-170644135 CAATGAGAACACATGGACAGAGG - Intergenic
1020159577 7:5759169-5759191 CAATCATGACAGAAGGAAAAGGG - Intronic
1020475339 7:8587679-8587701 CAATAAGAACACATGGACACAGG - Intronic
1020478796 7:8631872-8631894 AAATAAAGACACATGGAAATTGG - Intronic
1020545500 7:9524022-9524044 CAATGAGAACACATGGAAACAGG - Intergenic
1020724703 7:11797362-11797384 CAGGAAGGAAAGAAGGAAAGAGG - Intronic
1021060327 7:16103251-16103273 CAATGAGGACACATGGACACAGG + Intronic
1021264510 7:18503306-18503328 CAATAAGGAAGCAAAGAAAGAGG + Intronic
1021306110 7:19034441-19034463 CAATAAGAACACATGGACACAGG - Intronic
1021332911 7:19360454-19360476 CAATGAGAACACATGGACAGAGG - Intergenic
1022136959 7:27457904-27457926 GAAAAAGGACAGAAGGAAAATGG + Intergenic
1022519661 7:30998068-30998090 CAAGAAGGAAACAAGAAACGTGG - Intergenic
1022588336 7:31636929-31636951 CAATAAGAACACATGGATACAGG - Intronic
1023210505 7:37798941-37798963 CCAATAGAACACAAGGAAAGTGG + Intronic
1023397407 7:39763889-39763911 CAAGAAGGAAAAAAGGAAGGAGG - Intergenic
1023531066 7:41154906-41154928 CAATAAGAACACATGGACACAGG - Intergenic
1023697162 7:42859337-42859359 CAATGAGGACACATGGGAACAGG - Intergenic
1023716977 7:43054507-43054529 CAATAAGGAGGAAGGGAAAGCGG - Intergenic
1023858335 7:44200512-44200534 CAATAAGAACACATGGACACAGG + Intergenic
1023987976 7:45108988-45109010 CAAGAAGGCCACAAGGCCAGAGG - Exonic
1024107321 7:46106429-46106451 CTCTAAGGACACAGAGAAAGTGG + Intergenic
1024590440 7:50877694-50877716 CAATGAGGACACATGGATACAGG + Intergenic
1024674113 7:51622847-51622869 CAAGAAGGCCAAAAGGAAATAGG + Intergenic
1024899007 7:54295631-54295653 CAATAAGAACACATGGACACAGG + Intergenic
1025079514 7:55969531-55969553 CAATGATGACACAAGGAAGTAGG - Intronic
1025521221 7:61732166-61732188 CAATGAGAACACATGGACAGAGG + Intergenic
1025545033 7:62154679-62154701 CAATGAGGACACATGGACACAGG + Intergenic
1025594613 7:62909069-62909091 CAATAAGAACACATGGACACAGG - Intergenic
1025636245 7:63322209-63322231 CAATAAGAACACATGGACATAGG + Intergenic
1025646451 7:63425967-63425989 CAATAAGAACACATGGACATAGG - Intergenic
1026329190 7:69337203-69337225 CCCCAAGGACACAAGGGAAGAGG - Intergenic
1026658449 7:72277608-72277630 AAATAAGCACACAAGCAAAATGG + Intronic
1026926183 7:74195545-74195567 GAAAAAGGACAGAAGGAAAATGG - Exonic
1027365577 7:77454436-77454458 CAATAAGGACTCAGGAAAACAGG + Intergenic
1027646706 7:80810590-80810612 CAGTAAGTAGACAACGAAAGAGG - Exonic
1027728861 7:81843701-81843723 CAATGAGAACACATGGACAGAGG - Intergenic
1027746050 7:82075056-82075078 CAATGAGGACACATGGACACAGG - Intronic
1027935025 7:84590642-84590664 CAATGAGAACACATGGACAGGGG - Intergenic
1027963532 7:84977342-84977364 CAATAAGAACACATGGACACAGG + Intergenic
1028140311 7:87266294-87266316 CAATGAGAACACATGGACAGAGG + Intergenic
1028283940 7:88970765-88970787 CAATGAGAACACAAGGACACAGG + Intronic
1028288458 7:89034444-89034466 CAATGAGAACACATGGACAGAGG - Intronic
1028886970 7:95944820-95944842 CAATGAGGACACATGGACACCGG + Intronic
1029801579 7:102953388-102953410 CAATAATAATAGAAGGAAAGAGG + Intronic
1029869661 7:103677209-103677231 CAATAAGAACACATGGACATAGG + Intronic
1030226355 7:107156052-107156074 CAATAAGAACACATGGACACAGG + Intronic
1030251384 7:107449122-107449144 CAATAAGAACACATGGACACAGG + Intronic
1030555037 7:111013404-111013426 CAATAAGGACAGAAAGAAACAGG + Intronic
1031152474 7:118070388-118070410 CAATAAGAACACATGGACACAGG + Intergenic
1031175383 7:118342064-118342086 CAATAAGAACACATGGACACAGG - Intergenic
1031856400 7:126928165-126928187 CAATAAGAACACATGGACACAGG + Intronic
1031864749 7:127026045-127026067 CAATGAGAACACAAGGACACAGG - Intronic
1032745589 7:134783220-134783242 CACTAAAGACAGAAGCAAAGAGG - Intronic
1032860416 7:135872913-135872935 CAATAAGAACACATGGACACAGG - Intergenic
1032974803 7:137210019-137210041 CAATGAGAACACATGGACAGAGG - Intergenic
1033681621 7:143601040-143601062 CAATAAGAACACATGGACACAGG + Intergenic
1033703271 7:143860773-143860795 CAATAAGAACACATGGACACAGG - Intronic
1033803225 7:144925599-144925621 CAATAAGAACACATGGACACAGG - Intergenic
1033933336 7:146551332-146551354 CAATAAGAACACATGGACACAGG - Intronic
1033993641 7:147318611-147318633 CAATAAGAACACATGGACACAGG + Intronic
1034864642 7:154630731-154630753 CAATAAGAACACATGGACACCGG + Intronic
1035137556 7:156719175-156719197 CAATGAGAACACATGGACAGAGG - Intronic
1035509246 8:162494-162516 CAATGAGAACACATGGACAGAGG + Intergenic
1035711608 8:1720782-1720804 CAATGAGAACACATGGAAACAGG + Intergenic
1035906023 8:3511177-3511199 CAATGAGGACACAAGGGCACAGG + Intronic
1036046722 8:5151016-5151038 CAATAAGAACACATGGACACAGG - Intergenic
1036985640 8:13526719-13526741 CAATAAGAACACATGGACACAGG + Intergenic
1037286586 8:17307834-17307856 CAATGAGAACACAAGGACACAGG + Intronic
1038074222 8:24051859-24051881 CAATGAGAACACATGGACAGAGG + Intergenic
1038182442 8:25241950-25241972 CAATGAGAACACAAGGACACAGG + Intronic
1038855234 8:31323849-31323871 CAATAAGAACACATGGACATGGG - Intergenic
1038916662 8:32031655-32031677 CAATAAGAACACATGGACACAGG - Intronic
1038993358 8:32893965-32893987 AAATAAGGAAAGAAAGAAAGTGG - Intergenic
1039030777 8:33307222-33307244 CAATAAGAACACATGGACACAGG + Intergenic
1039170921 8:34743983-34744005 CAATAAGAACACATGGACACAGG + Intergenic
1039183109 8:34888367-34888389 CAACAAGGTCACAAGGCAAAGGG + Intergenic
1039346728 8:36713090-36713112 CAATGAGGACACATGGACACAGG + Intergenic
1039718650 8:40138413-40138435 CAATGAGAACACAAGGACACAGG - Intergenic
1039808577 8:41024788-41024810 CAATAAGAACACATGGACACAGG + Intergenic
1039988675 8:42469100-42469122 AATTAAGGACAGAGGGAAAGAGG + Intronic
1040024193 8:42766685-42766707 CAATGAGGACACATGGACACAGG + Intronic
1040642937 8:49361534-49361556 TGATAAGGACACAGAGAAAGGGG - Intergenic
1040643057 8:49363135-49363157 TGATAAGGACACAGAGAAAGGGG - Intergenic
1040759650 8:50823923-50823945 CAATGAGAACACATGGAAACAGG + Intergenic
1041008585 8:53519520-53519542 CAATGAGGACACATGGACACAGG + Intergenic
1041277840 8:56181514-56181536 CAATAAGAACACATGGACACAGG + Intronic
1041484834 8:58363761-58363783 CAATGAGAACACATGGACAGAGG - Intergenic
1041683006 8:60612172-60612194 CAATAAGAACACATGGACACAGG - Intronic
1041820217 8:62023219-62023241 CAATGAGAACACATGGACAGAGG + Intergenic
1042065689 8:64873087-64873109 CAATGAGGACAAAAGGAACTTGG - Intergenic
1042085112 8:65098986-65099008 CAATAAGAACACATGGACACAGG + Intergenic
1042467961 8:69149955-69149977 CAATGAGAACACAAGGACACAGG + Intergenic
1042568090 8:70132915-70132937 CATTAGGTACATAAGGAAAGTGG + Intronic
1042726207 8:71880107-71880129 CAATGAGAACACATGGAAACAGG + Intronic
1042730957 8:71934321-71934343 CAATGAGAACACATGGACAGGGG - Intronic
1042997503 8:74717200-74717222 CAATAAGAACACATGGACACAGG - Intronic
1043207794 8:77469085-77469107 CAATAAGAACACATGGACACAGG - Intergenic
1043589555 8:81812859-81812881 CAATAGCAACACAAAGAAAGAGG + Intronic
1044048341 8:87465954-87465976 CAATAAGAACACATGGACACAGG + Intronic
1044053407 8:87538438-87538460 CAATGAGAACACAAGGACACAGG - Intronic
1044763378 8:95546613-95546635 CAATAAGAACACATGGACACAGG + Intergenic
1044882499 8:96738654-96738676 CAATAAGAACACATGGACACAGG - Intronic
1044987838 8:97770725-97770747 CAATAAGAACACATGGACACAGG + Intergenic
1045064714 8:98435123-98435145 CAATGAGGACACGAGGAAAGAGG + Intronic
1045126930 8:99102228-99102250 GAATAAGAACACAGGGAAATAGG - Intronic
1045809985 8:106210174-106210196 CAACAAGAACACATGGATAGAGG + Intergenic
1045829735 8:106444634-106444656 CAATGAGAACACAAGGACACAGG + Intronic
1045948419 8:107824283-107824305 CAATAAGAACACATGGACACAGG - Intergenic
1045965653 8:108021717-108021739 CAATAAGAACACATGGACACAGG + Intronic
1046042518 8:108923252-108923274 CAATAAGGATCCAAAAAAAGTGG + Intergenic
1046152986 8:110253289-110253311 CAATAAGAACACATGGACACAGG - Intergenic
1046191849 8:110806348-110806370 CAATAAGAACACATGGACACAGG - Intergenic
1046234804 8:111409024-111409046 CAATGAGAACACATGGAAAGAGG - Intergenic
1046247325 8:111581466-111581488 CAACAAGAACACATGGACAGAGG - Intergenic
1046557717 8:115796176-115796198 CAATAAGAACACATGGACACAGG - Intronic
1046646900 8:116795027-116795049 CAATAAGAACACATGGACACAGG - Intronic
1046725870 8:117673185-117673207 CAATGAGGACACATGGACACAGG - Intergenic
1046727766 8:117693259-117693281 CAATACAGAGACAAGCAAAGAGG + Intergenic
1047297387 8:123583295-123583317 CAATGAGAACACATGGAAACAGG + Intergenic
1047324308 8:123821602-123821624 CAATGAGGACACATGGACACAGG + Intergenic
1047472589 8:125191943-125191965 AAATACGTTCACAAGGAAAGGGG + Intronic
1047660196 8:127025268-127025290 CAATGAGAACACAAGGACACAGG + Intergenic
1048040509 8:130723116-130723138 CAATAAGAACACATGGATACAGG - Intergenic
1048090161 8:131231807-131231829 AAATAAGAACACATGGAAACAGG - Intergenic
1048093818 8:131269141-131269163 CAATAAGAACACATGGAAACAGG + Intergenic
1048120457 8:131575240-131575262 CAATGAGAACACATGGAAATAGG + Intergenic
1048122829 8:131600672-131600694 CAATGAGAACACAAGGACACAGG - Intergenic
1048229035 8:132619245-132619267 CAATGAGAACACATGGACAGAGG + Intronic
1048232120 8:132652738-132652760 CAATAAGAACACATGGACACAGG + Intronic
1048520584 8:135150512-135150534 CAATAAGAACACATGGACACAGG - Intergenic
1048624279 8:136167679-136167701 CAATGAGGACACATGGACACAGG + Intergenic
1048629854 8:136230587-136230609 CAATGAGAACACAAGGACACAGG - Intergenic
1049333382 8:142068077-142068099 CAATGAGAACACAAGGACACAGG + Intergenic
1049999924 9:1066352-1066374 CAATAAGAACACATGGATACAGG - Intergenic
1050105422 9:2161129-2161151 CAATTAGTAAACAAGGAAACGGG - Intronic
1050656648 9:7835920-7835942 CAATGAGGACACATGGACACAGG - Intronic
1050781576 9:9342926-9342948 CAATGAGAACACATGGAAACAGG - Intronic
1050895614 9:10882821-10882843 AAGTAAGGCCTCAAGGAAAGGGG + Intergenic
1050925837 9:11261815-11261837 CAATGAGAACACATGGAAACTGG + Intergenic
1051003861 9:12317993-12318015 CGATAAGAACATAAGTAAAGTGG + Intergenic
1051481022 9:17561631-17561653 CTATAAAGACACAATGAAAAAGG + Intergenic
1051491714 9:17674016-17674038 CAAGAGCCACACAAGGAAAGAGG - Intronic
1051519699 9:17972357-17972379 CAATGAGGACACATGGACACAGG - Intergenic
1051884371 9:21874888-21874910 CAATAAGAACACATGGACACAGG - Intronic
1051916999 9:22220530-22220552 CAATGAGAACACATGGACAGAGG - Intergenic
1051939641 9:22490316-22490338 CAATAAGAACAAAAGGACACAGG - Intergenic
1052003492 9:23317543-23317565 CAATGAGAACACAAGGACACGGG - Intergenic
1052153438 9:25150301-25150323 CAATAAGAACACATGGACACAGG + Intergenic
1052457677 9:28721606-28721628 CAATGAGAACACATGGAAACAGG + Intergenic
1052465975 9:28829889-28829911 CAAAAAAGATAAAAGGAAAGAGG + Intergenic
1052482809 9:29053374-29053396 CAATGAGAACACATGGACAGAGG - Intergenic
1052720956 9:32170375-32170397 CTATAAGGGAGCAAGGAAAGAGG + Intergenic
1052722187 9:32185512-32185534 CAATCATGACAGAAGGCAAGGGG + Intergenic
1053287931 9:36861894-36861916 CAATGGGGAGACCAGGAAAGAGG + Intronic
1053536036 9:38927209-38927231 CAATAAGAACACATGGACACAGG - Intergenic
1053650394 9:40163065-40163087 CAATAAGAACACATGGATACAGG - Intergenic
1053755343 9:41300861-41300883 CAATAAGAACACATGGATACAGG + Intergenic
1054534190 9:66213138-66213160 CAATAAGAACACATGGATACAGG + Intergenic
1054630099 9:67436743-67436765 CAATAAGAACACATGGACACAGG + Intergenic
1055203867 9:73702304-73702326 CAATAATAGCACAAGGAAGGAGG + Intergenic
1055504691 9:76935910-76935932 CAATAAGAACACATGGACACAGG - Intergenic
1055580862 9:77705095-77705117 CAATAAGAACACATGGACACAGG - Intergenic
1055743928 9:79421974-79421996 CAATGAGAACACAAGGACACAGG - Intergenic
1055852777 9:80652295-80652317 CAATGAGGACACATGGACACGGG - Intergenic
1056002929 9:82236524-82236546 CAATAAGTACACATGGACACAGG - Intergenic
1056081322 9:83096826-83096848 CAATAAGAACACATGGACACAGG - Intergenic
1056335592 9:85565553-85565575 CAATAAAGAGAAAAGGACAGGGG + Intronic
1056416091 9:86377658-86377680 CAATGAGGACACATGGACACAGG - Intergenic
1056425765 9:86474929-86474951 CAATAAGAACACATGGACACAGG - Intergenic
1056527442 9:87456491-87456513 CAATAATGGCAGAAGGAAAAAGG + Intergenic
1056856065 9:90130653-90130675 CAATGAGAACACATGGAAACAGG - Intergenic
1057435341 9:95035163-95035185 CAATGAGAACACACGGAAACAGG - Intronic
1057535173 9:95895489-95895511 CCAAAAGGACACAAAAAAAGTGG - Intronic
1058183947 9:101831682-101831704 CAATGAGAACACATGGAAACAGG + Intergenic
1058329473 9:103741050-103741072 CAATCAGGGCAGAAGGCAAGAGG + Intergenic
1058501238 9:105619516-105619538 CAATAAGTACTTAAGTAAAGTGG - Intronic
1059013195 9:110485379-110485401 CAATGAGAACACATGGAAACAGG + Intronic
1059056139 9:110982423-110982445 CAATAAGAACACATGGACACAGG + Intronic
1059851147 9:118341707-118341729 CAATGAGGACACATGGACATAGG - Intergenic
1060868918 9:127023456-127023478 GAACAAGGAAGCAAGGAAAGAGG - Intronic
1061722565 9:132561830-132561852 CAGTAAGAAGGCAAGGAAAGAGG + Intronic
1062758725 9:138324405-138324427 CAATGAGAACACATGGACAGAGG - Intergenic
1202798284 9_KI270719v1_random:147755-147777 CAATAAGAACACATGGATACAGG - Intergenic
1203359312 Un_KI270442v1:198252-198274 CAATGAGAACACATGGAAACAGG + Intergenic
1203368662 Un_KI270442v1:280806-280828 CAATGAGGACACATGGACACAGG + Intergenic
1203617269 Un_KI270749v1:77532-77554 CAATGAGAACACATGGACAGAGG + Intergenic
1185715662 X:2340136-2340158 CAATAAGAACACATGGACACGGG + Intronic
1185726826 X:2428567-2428589 CAATGAGAACACATGGAAACAGG + Intronic
1186110170 X:6247006-6247028 CAATGAGGACACATGGACACAGG - Intergenic
1186634504 X:11387747-11387769 CAATAAGAACACATGGACACAGG - Intronic
1186644445 X:11491407-11491429 CAATGAGAACACATGGAAACAGG - Intronic
1186774320 X:12849005-12849027 CAATAAGAACACATGGACACAGG - Intergenic
1186900208 X:14046367-14046389 CAATGAGGACACATGGACACAGG - Intergenic
1187177928 X:16913548-16913570 CAAAAAGGAAAGAAAGAAAGAGG - Intergenic
1187186593 X:16992563-16992585 CAATAAAAACATAAGGAAGGTGG - Intronic
1187938354 X:24357836-24357858 CAATAAAGACACAATGATATTGG + Intergenic
1187994275 X:24908432-24908454 CAATGAGGACACATGGACACAGG - Intronic
1188103293 X:26117368-26117390 CAATATAGACTTAAGGAAAGTGG - Intergenic
1188440515 X:30211361-30211383 CAATAAGAACACATGGACACAGG + Intergenic
1188998517 X:36916203-36916225 CAATAAGAACACATGGACACAGG + Intergenic
1189778036 X:44487789-44487811 GAAGAAGGAAAGAAGGAAAGGGG + Intergenic
1189868427 X:45355774-45355796 CAAAGAGGACACAAGAAAACTGG - Intergenic
1190188964 X:48259645-48259667 CAATGAGAACACAAGGACACGGG - Intronic
1190504884 X:51117662-51117684 CAATGAGAACACATGGAAACAGG + Intergenic
1190510707 X:51171233-51171255 CAATAAGAACACATGGACACAGG + Intergenic
1190592523 X:52019260-52019282 CAATGAGAACACAAGGACACAGG - Intergenic
1190921188 X:54854124-54854146 CAATAAGAACACATGGACACTGG - Intergenic
1190963219 X:55272719-55272741 CAATGAGGACACATGGACACAGG + Intronic
1190977801 X:55424084-55424106 CAATGAGAACACAAGGACAAAGG + Intergenic
1191049136 X:56172300-56172322 CAATAAGAACACATGGACACAGG - Intergenic
1191064742 X:56335839-56335861 CAATAAGAACACATGGACACAGG - Intergenic
1191163447 X:57360870-57360892 CAATAAGAACACATGGACACAGG - Intronic
1191238202 X:58153628-58153650 CAATAAGAACACATGGACACAGG - Intergenic
1191597449 X:62960954-62960976 CAATAAGAACACATGGACACAGG - Intergenic
1191777080 X:64826459-64826481 CAATGAGAACACATGGAAAAAGG + Intergenic
1191827788 X:65384316-65384338 CAATAAGAACACATGGACACAGG + Intronic
1192006842 X:67223519-67223541 CAATAAGAACACATGGACACAGG + Intergenic
1192041464 X:67626824-67626846 CAATGAGAACACATGGACAGAGG - Intronic
1192160324 X:68781621-68781643 CAATGAGAACACATGGACAGAGG + Intergenic
1192258142 X:69483410-69483432 CAATAAGAACACATGGACACAGG + Intergenic
1192302776 X:69923333-69923355 CAATAAGAACACATGGACACAGG - Intronic
1192355516 X:70399748-70399770 CAATGAGAACACATGGACAGAGG + Intronic
1192716950 X:73653170-73653192 CAATAAGAACACATGGACACAGG + Intronic
1192852324 X:74970379-74970401 CAATAAGAACACATGGACACAGG - Intergenic
1192874424 X:75212736-75212758 CAATAAGAACACATGGACACAGG + Intergenic
1192921345 X:75710089-75710111 CAATTAGGACACATGGACACAGG - Intergenic
1193018157 X:76759328-76759350 CAATAAGAACACATGGACACAGG + Intergenic
1193210608 X:78802569-78802591 CAATGAGGACACATGGACACAGG - Intergenic
1193217836 X:78885449-78885471 CAATGAGAACACATGGACAGGGG + Intergenic
1193280910 X:79649405-79649427 CAATAAGAACACATGGACACGGG - Intergenic
1193289479 X:79754637-79754659 CAAAATGAACAAAAGGAAAGAGG - Intergenic
1193437600 X:81496441-81496463 CAATAAGAACACATGGACACAGG + Intergenic
1193448296 X:81633778-81633800 CAATAAGAACACACGGACACAGG - Intergenic
1193523921 X:82565710-82565732 CAATGAGGACACATGGACATAGG - Intergenic
1193540142 X:82761224-82761246 CAATAAGAACACACGGAAACAGG - Intergenic
1193566835 X:83086993-83087015 CAATAAGAACACATGGACACAGG - Intergenic
1193568905 X:83116941-83116963 CAATGAGAACACATGGACAGAGG - Intergenic
1193624391 X:83798708-83798730 CAATGAGGACACATGGACACAGG + Intergenic
1193692913 X:84668866-84668888 CAATGAGAACACATGGACAGAGG - Intergenic
1193777610 X:85663139-85663161 CAATGAGAACACATGGAAACAGG + Intergenic
1193786588 X:85767085-85767107 CAATGAGAACACATGGAGAGAGG - Intergenic
1193919954 X:87412944-87412966 CAATGAGAACACATGGACAGAGG - Intergenic
1193956631 X:87871835-87871857 CAATGAGAACACATGGACAGAGG + Intergenic
1194132644 X:90100755-90100777 CAATGAGAACACATGGAAACAGG - Intergenic
1194261708 X:91703545-91703567 CAATAAGAACACATGGACACAGG + Intergenic
1194560545 X:95413462-95413484 CAATAAGAACACATGGACACAGG - Intergenic
1194633950 X:96321024-96321046 CAATGAGAACACATGGACAGAGG - Intergenic
1194802068 X:98286219-98286241 CAATAATGGCAGAAGGCAAGGGG - Intergenic
1194953147 X:100150774-100150796 CAATGAGAACACAAGGACACAGG - Intergenic
1194990279 X:100539736-100539758 CAATGAGAACACAAGGACACAGG - Intergenic
1195213593 X:102674341-102674363 CAATGAGAACACATGGACAGAGG - Intergenic
1195722830 X:107883148-107883170 CAATGAGAACACATGGAAACAGG + Intronic
1195774272 X:108385912-108385934 CAATAAGAACACATGGACACAGG - Intronic
1195823527 X:108972302-108972324 CAATAAGAACACAAGGACACTGG + Intergenic
1195897574 X:109762715-109762737 CAATAAGAACACATGGACACAGG + Intergenic
1196019052 X:110970544-110970566 CAATAAGAACACATGGACATCGG + Intronic
1196116488 X:112004918-112004940 CAACATGGACACCAGGAAATTGG + Intronic
1196199229 X:112866978-112867000 CAATGAGGACACATGGACATAGG + Intergenic
1196524786 X:116719537-116719559 CAATCATGGCACAAGGCAAGGGG - Intergenic
1196563881 X:117181865-117181887 CAATGAGAACACAAGGACACAGG + Intergenic
1196575000 X:117306603-117306625 CAATGAGAACACATGGACAGGGG - Intergenic
1196619350 X:117804902-117804924 AAATATGGAAAGAAGGAAAGAGG + Intergenic
1196945598 X:120822100-120822122 CAATGAGGACACATGGACACAGG + Intergenic
1197003328 X:121466107-121466129 CAAAAATGAAACAGGGAAAGTGG - Intergenic
1197091703 X:122546878-122546900 CAATGAGAACACATGGAAACAGG - Intergenic
1197105306 X:122707024-122707046 CAATAAGAACACGAGGACACAGG + Intergenic
1197123269 X:122915647-122915669 CAATAAGAACACATGGACACAGG - Intergenic
1197135026 X:123050868-123050890 CAATGAGAACACATGGACAGAGG - Intergenic
1197135263 X:123052971-123052993 CAATGAGAACACATGGACAGAGG + Intergenic
1197191633 X:123654202-123654224 CAATTAGAACACAAGGACACAGG + Intronic
1197965101 X:132051789-132051811 CAATGAGAACACATGGAAACAGG - Intergenic
1198270071 X:135048464-135048486 CAATGAGAACACAAGGACACAGG + Intergenic
1198331986 X:135630539-135630561 CAATCAGAGCACCAGGAAAGAGG - Intergenic
1198555278 X:137786411-137786433 CAATGAGAACACATGGACAGAGG + Intergenic
1198833548 X:140777087-140777109 CAATGAGGACACATGGACACTGG + Intergenic
1198859994 X:141058507-141058529 AAAAAATGACATAAGGAAAGAGG + Intergenic
1198902699 X:141528883-141528905 AAAAAATGACATAAGGAAAGAGG - Intergenic
1198927966 X:141821034-141821056 CAATAGGGACACAAAAAAGGTGG - Intergenic
1199135214 X:144242283-144242305 AAAAAGGAACACAAGGAAAGAGG + Intergenic
1199555056 X:149098134-149098156 CAAGAAGGAGAGAAGGAAGGAGG + Intergenic
1199567952 X:149235823-149235845 CAATAAGAACACATGGACACAGG + Intergenic
1199614134 X:149642062-149642084 AAATAAGGAAACAATGAAAGAGG - Intergenic
1200179252 X:154140493-154140515 CAAGAAAGCCCCAAGGAAAGAGG - Intergenic
1200254403 X:154572277-154572299 GAATAAGGAAAAAAGGAAGGAGG - Intergenic
1200263366 X:154632131-154632153 GAATAAGGAAAAAAGGAAGGAGG + Intergenic
1200290892 X:154872495-154872517 CAATGAGAACACATGGAAACAGG + Intronic
1200343838 X:155427912-155427934 CAATAAGAACACATGGATACAGG + Intergenic
1200355141 X:155541239-155541261 CAATGAGGACACATGGACACAGG - Intronic
1200365641 X:155659502-155659524 GAGTAAGGACACAATGAAAAGGG - Intronic
1200478431 Y:3670834-3670856 CAATGAGAACACATGGAAACAGG - Intergenic
1200580358 Y:4942339-4942361 CAATAAGAACACATGGACACAGG + Intergenic
1200698101 Y:6378865-6378887 CAATAAGAACACATGGACACAGG - Intergenic
1200735905 Y:6795099-6795121 CAATAAGAACACATGGACACAGG - Intergenic
1200825374 Y:7633133-7633155 CAATGAGAACACATGGAAACAGG + Intergenic
1200909594 Y:8518033-8518055 CAATGAGGACACATGGACACAGG + Intergenic
1201036011 Y:9785834-9785856 CAATAAGAACACATGGACACAGG + Intergenic
1201053208 Y:9961803-9961825 CAATAAGAACACATGGACACAGG - Intergenic
1201069909 Y:10137661-10137683 CAATGAGGACACATGGACACAGG - Intergenic
1201080161 Y:10236284-10236306 CAATAAGAACACATGGACACAGG - Intergenic
1201356582 Y:13103497-13103519 CAATAAGAACACACGGACACAGG + Intergenic
1201398398 Y:13574970-13574992 CAATGAGAACACAAGGACACAGG + Intergenic
1201459377 Y:14205376-14205398 CAATAAGAACACATGGACACAGG - Intergenic
1201481279 Y:14442006-14442028 CAATGAGAACACAAGGACACAGG + Intergenic
1201532787 Y:15010552-15010574 CAATAAGAACACATGGACACAGG - Intergenic
1201570812 Y:15412057-15412079 CAATGAGAACACATGGACAGAGG + Intergenic
1201768135 Y:17592293-17592315 CAATGAGAACACAAGGACACAGG + Intergenic
1201833418 Y:18313692-18313714 CAATGAGAACACAAGGACACAGG - Intergenic
1201887342 Y:18899714-18899736 CAATGAGAACACATGGACAGAGG + Intergenic
1201959478 Y:19663018-19663040 CAAGAAGAACACAAGGACATGGG + Intergenic
1202124851 Y:21558347-21558369 CAATAAGAACACAGGGACACAGG + Intergenic
1202154157 Y:21871033-21871055 CAATAAGAACACAGGGACACAGG - Intergenic
1202234684 Y:22697954-22697976 CAATGAGAACACATGGAAACAGG - Intergenic
1202308475 Y:23498214-23498236 CAATGAGAACACATGGAAACAGG + Intergenic
1202562326 Y:26172372-26172394 CAATGAGAACACATGGAAACAGG - Intergenic