ID: 1160702175

View in Genome Browser
Species Human (GRCh38)
Location 19:512926-512948
Sequence ACCCGCGCGGCTCTTGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160702175_1160702181 -10 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702181 19:512939-512961 CCGCGCGGGTTCCCCTGCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 50
1160702175_1160702193 27 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702193 19:512976-512998 CGTCGAGCCCCGGGGGAGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 88
1160702175_1160702190 19 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702190 19:512968-512990 CCGCCTCGCGTCGAGCCCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1160702175_1160702182 -5 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702182 19:512944-512966 CGGGTTCCCCTGCGGGGGACTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1160702175_1160702188 18 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702188 19:512967-512989 GCCGCCTCGCGTCGAGCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 61
1160702175_1160702187 17 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702187 19:512966-512988 GGCCGCCTCGCGTCGAGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 76
1160702175_1160702191 20 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702191 19:512969-512991 CGCCTCGCGTCGAGCCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1160702175_1160702183 -4 Left 1160702175 19:512926-512948 CCGCTGCCAAGAGCCGCGCGGGT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1160702183 19:512945-512967 GGGTTCCCCTGCGGGGGACTGGG 0: 1
1: 0
2: 3
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160702175 Original CRISPR ACCCGCGCGGCTCTTGGCAG CGG (reversed) Intronic
901780700 1:11592839-11592861 ACCCGCAAGGCTCTTGGAATTGG + Intergenic
903125459 1:21244529-21244551 ACCCTCAGGGCTCCTGGCAGGGG + Intronic
903263872 1:22144953-22144975 ACCCACGCAGGTCCTGGCAGTGG + Intergenic
905651439 1:39659645-39659667 ACCAGCGCGGCTCTAGTCAGGGG + Intronic
906548108 1:46636905-46636927 ACTCACATGGCTCTTGGCAGAGG - Intronic
913569961 1:120110190-120110212 CCCTGCGCGGCCCTAGGCAGCGG - Intergenic
914290769 1:146271155-146271177 CCCTGCGCGGCCCTAGGCAGCGG - Intergenic
914551813 1:148721938-148721960 CCCTGCGCGGCCCTAGGCAGCGG - Intergenic
920845907 1:209592777-209592799 ACAAGCGAGGCTCTTGGCAGAGG - Intronic
1084516821 11:69642055-69642077 AGCCGCGCGGCCCTTAGCTGCGG - Intronic
1092894788 12:13001146-13001168 ACCCGCGCGGCTCGGAGCAATGG - Intergenic
1104597688 12:130131319-130131341 CCCCGCGGAGCTCTGGGCAGAGG - Intergenic
1113480270 13:110615495-110615517 CTCCGCGCGGCTGTCGGCAGTGG - Intronic
1122972180 14:105156861-105156883 ACCCCAGCGGCTCAGGGCAGGGG - Intronic
1124199834 15:27669646-27669668 AACCTCACGGTTCTTGGCAGTGG - Intergenic
1129139022 15:73579776-73579798 ACTCACATGGCTCTTGGCAGTGG - Intronic
1132314201 15:100879101-100879123 ACCCGGGCGGCTCTCCGCCGAGG - Intronic
1135407153 16:22206631-22206653 ACCCTCGCGGCCGTGGGCAGCGG + Exonic
1136104368 16:28018960-28018982 ACCCGAGCAGATCATGGCAGTGG - Intronic
1139545600 16:67648228-67648250 CCCCCCGCAGCTCTTCGCAGCGG + Exonic
1142245513 16:88968421-88968443 AGCCTCACGGCTCCTGGCAGTGG + Intronic
1143129979 17:4671963-4671985 ACCCGGGCTGCTTTTGGAAGTGG - Exonic
1144469500 17:15524905-15524927 CACCACTCGGCTCTTGGCAGTGG + Intronic
1144926855 17:18818772-18818794 CACCACTCGGCTCTTGGCAGTGG - Intergenic
1148452668 17:47790128-47790150 ACCCACGCCGCTCTGGGCACAGG + Intergenic
1152729464 17:81962317-81962339 ACTCCCGAGGCTCTGGGCAGTGG + Intergenic
1160702175 19:512926-512948 ACCCGCGCGGCTCTTGGCAGCGG - Intronic
1163311747 19:16519133-16519155 ACCGGCGCGGCTCCCGGCATGGG + Exonic
1167880206 19:52451359-52451381 ACGCGCGAGGCTCACGGCAGAGG + Intronic
925170253 2:1745671-1745693 ACCCCCGAGGCTGCTGGCAGGGG + Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
1171199912 20:23232455-23232477 ACTCAGGTGGCTCTTGGCAGAGG - Intergenic
1179480231 21:41672264-41672286 TCCCGCGCGGCCTCTGGCAGTGG - Intergenic
1180100383 21:45581241-45581263 ACCCGTGCCCCTCTTGGGAGTGG + Intergenic
1185057042 22:48586545-48586567 ACACGCCCAGCACTTGGCAGGGG - Intronic
951826474 3:26874646-26874668 ATCCTCACGGCTGTTGGCAGAGG + Intergenic
975681387 4:76880109-76880131 ACCCACATGGCTCTTGGTAGAGG - Intergenic
984024091 4:174522399-174522421 ACCGGCGCGGCTCAGGGCATAGG - Exonic
996738240 5:126776828-126776850 ACCCGCGCGGCTCTGGGCCCAGG - Intronic
1000023991 5:157343101-157343123 ACCATCGCGGCTCATGGCAACGG + Exonic
1034342708 7:150368664-150368686 ACCCGGCCCGCTCTTGGCGGGGG + Intronic
1035229918 7:157458719-157458741 ACCCGCACTGCTCCAGGCAGAGG - Intergenic
1048328369 8:133455642-133455664 ACCCCCGGGGCTCTTCTCAGGGG + Exonic
1048862189 8:138731708-138731730 ACCCGTGCTGCTGTTGGCTGAGG + Intronic
1062105214 9:134751432-134751454 ACCCACGTGGCTCCTGGAAGGGG + Intronic