ID: 1160702315

View in Genome Browser
Species Human (GRCh38)
Location 19:513605-513627
Sequence CAGTAGGTGTTCAGTAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 3, 2: 11, 3: 19, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160702315_1160702320 17 Left 1160702315 19:513605-513627 CCTGCATTACTGAACACCTACTG 0: 1
1: 3
2: 11
3: 19
4: 158
Right 1160702320 19:513645-513667 ACTGAGCACCTACTGCATACTGG 0: 1
1: 7
2: 36
3: 140
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160702315 Original CRISPR CAGTAGGTGTTCAGTAATGC AGG (reversed) Intronic
903007392 1:20307710-20307732 CAGTAGGTGCTTATCAATGCTGG + Intronic
906153658 1:43601876-43601898 CAGTTGGTGCTCAGTGAGGCAGG + Intronic
907249987 1:53131694-53131716 TAGTAGGTGCTCATTAATACTGG - Intronic
907307855 1:53523491-53523513 CAGTAGGTGCTCTGTAAATCTGG + Intronic
907897911 1:58710062-58710084 CAGTAGGAGCTCATTAATGCTGG - Intergenic
913334636 1:117697951-117697973 CAGTAGGTATTCAATAAAGGTGG - Intergenic
914193852 1:145433787-145433809 CAGGAGGTGTTGAGTGAGGCCGG + Intergenic
914475181 1:148016661-148016683 CAGGAGGTGTTGAGTGAGGCCGG + Intergenic
915737128 1:158092093-158092115 CAATAGGTGTTCAGTAAGTATGG + Intronic
916852345 1:168716418-168716440 CTATAGGGGCTCAGTAATGCAGG + Intronic
917512425 1:175679374-175679396 CAGTAGGTGTTCAGTAAATATGG - Intronic
919814164 1:201427301-201427323 CAGTAAGTGTTCAGTAAATGGGG + Intronic
921477717 1:215630928-215630950 CAGTATTTGTTTAGTATTGCAGG + Intronic
923854353 1:237829655-237829677 CAGTTGTTGATCAGTAAGGCAGG + Intronic
924258603 1:242207105-242207127 CAGTAGGTTTTGAGTAAAGTAGG - Intronic
1067836193 10:49643385-49643407 CAGGAGGTGTATAGTAGTGCAGG - Intronic
1067956492 10:50796680-50796702 AAGTAGGTGTTTAAAAATGCTGG - Intronic
1068679567 10:59805042-59805064 CTGTAGGTGTTCAGTACTCAAGG - Intronic
1073531354 10:104234983-104235005 CAGCAGGTGTTCCCAAATGCAGG + Intergenic
1073799220 10:107023053-107023075 CAGTATGTGTTCAGTAGAGAGGG + Intronic
1074029863 10:109676421-109676443 CAGTAGATATTAAGAAATGCTGG - Intergenic
1075466873 10:122658076-122658098 AAGTAGGTGTACAGAAATGCTGG - Intergenic
1075492835 10:122888296-122888318 CAGTTGGTGTTGGGCAATGCTGG + Intergenic
1075922778 10:126226688-126226710 TAGTAAGTGTTCAGTAATTGAGG + Intronic
1076423894 10:130353645-130353667 CAGTAGGTTTACAGAAATCCTGG + Intergenic
1077849446 11:6061346-6061368 CAGTCGGTAATCAGTAATGTTGG + Intergenic
1078271163 11:9796113-9796135 CAGTAGGTGCTCGGAAAAGCTGG - Intronic
1080184137 11:29459206-29459228 CAGTAAGTGTTCAGTGAAACAGG + Intergenic
1084304952 11:68276203-68276225 CAGTAGGTGAGCAGAAATGAGGG + Intergenic
1085498072 11:76990801-76990823 CTGTTGGTATTCAGTAATACAGG + Intronic
1087114792 11:94513417-94513439 CAGTAGGTGCTAAGGAATGATGG + Intergenic
1087925965 11:103919060-103919082 CCATAGGTGTTAAGAAATGCTGG - Intronic
1087947431 11:104180113-104180135 GAGGAGGTGTTCTGTAATACTGG + Intergenic
1089996598 11:122913717-122913739 CAGGAGATGTTCAGGAATGAGGG - Intronic
1092371385 12:7919329-7919351 CAGTAGGTTGGCAGTAAGGCAGG - Exonic
1093203071 12:16213251-16213273 TAGTAAGTGTTCAGTAAAGATGG - Intronic
1093495272 12:19749520-19749542 CTGTAGGTGTATAGGAATGCTGG + Intergenic
1094325667 12:29235690-29235712 CTGTAGGTGATCAGTAATGCTGG - Intronic
1098465449 12:70781862-70781884 GAGTAGCTCATCAGTAATGCAGG - Intronic
1099110999 12:78560860-78560882 CAGATGGTGTTCACTTATGCAGG + Intergenic
1100737227 12:97549844-97549866 AAGCAGGTGTTCATTAATGAAGG + Intergenic
1100827999 12:98492769-98492791 CAGCAGGTGGTCAGTAGGGCAGG + Intronic
1102016371 12:109650682-109650704 CAGTAGGTGTTCAATAAATGAGG + Intergenic
1102145048 12:110648829-110648851 CAGTAGTTGTACAGTAATTGAGG + Exonic
1103009770 12:117449165-117449187 TAGAAGGTGTTTAGGAATGCTGG + Intronic
1103254385 12:119528222-119528244 CAGTAGGTGTTAACTTGTGCTGG - Intronic
1104099825 12:125596698-125596720 CAGAAAGTGTTCAGTAGTTCAGG - Intronic
1104153534 12:126108189-126108211 CTGTAGGAGTTCAGTCAGGCTGG - Intergenic
1105545198 13:21346157-21346179 CAGTAGGCGCTCATCAATGCTGG - Intergenic
1107112125 13:36709465-36709487 GAGTAGTTGTTTAGTAAAGCAGG + Intergenic
1109465240 13:62723225-62723247 CAGTAGACTTTCAGTAAAGCAGG + Intergenic
1115522436 14:34246357-34246379 CAGTAGGTCATCAGGAATGTGGG - Intronic
1115666846 14:35560325-35560347 TAAAAGGTGTTCAGTACTGCTGG - Intronic
1115835746 14:37399930-37399952 CAGTGGGTGATCAATCATGCTGG - Intronic
1116147943 14:41099677-41099699 CAGAAGATGTACGGTAATGCTGG + Intergenic
1117090643 14:52246754-52246776 TAGTAGGTGGCCATTAATGCAGG - Intergenic
1119474502 14:74919357-74919379 CAGTAAGTGTTCAGTGAGGGTGG - Intronic
1119680462 14:76588613-76588635 CAGTAGACTTTCAGTAAAGCAGG + Intergenic
1121958440 14:98236431-98236453 CTGTGGGTTTTCAGAAATGCAGG - Intergenic
1129701953 15:77773332-77773354 CAGTGGGTGTTCATTCATGCTGG - Intronic
1130275791 15:82475757-82475779 CAGTAGTGCTTCAGTAGTGCTGG - Intergenic
1131068426 15:89448908-89448930 CAGGAGGTGTCCTGGAATGCGGG - Intergenic
1131120416 15:89819511-89819533 AATTAGATGTTCAGTAATGGAGG + Intergenic
1132762660 16:1518386-1518408 CAGTAGGTGTTCAGGGCTTCGGG - Intronic
1136073219 16:27801412-27801434 CAGTAAGTGTTTAATAATGCCGG + Intronic
1144816928 17:18040875-18040897 CAGCAGGTATTCAGGAATCCAGG - Intronic
1145224602 17:21117352-21117374 CAGAAGCTGTGCAGTGATGCTGG - Intergenic
1146224231 17:31051921-31051943 CAGGAGGTGTGCTGTAATGAAGG + Intergenic
1151393689 17:73804903-73804925 CAGTAGGTGCTCAGCAACACTGG - Intergenic
1152056855 17:78035433-78035455 TAGTAGGTGTTGAGTAATGCAGG + Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154254672 18:12772094-12772116 CAGAAGGAGTTCAGTAATGAAGG - Intergenic
1156178254 18:34573065-34573087 CAGTAGGTGCTCAGTAAACATGG + Intronic
1157945311 18:51972836-51972858 CAATAGGTCTACAGTACTGCCGG + Intergenic
1160702305 19:513540-513562 CAGTAGGTGCTCAGTAATGCTGG - Intronic
1160702315 19:513605-513627 CAGTAGGTGTTCAGTAATGCAGG - Intronic
1160702319 19:513637-513659 CAGTAGGTGCTCAGTAATGCTGG - Intronic
1160702323 19:513669-513691 CAGTAGGTACTCAGTAATGCAGG - Intronic
1160702327 19:513701-513723 CAGTAGGTACTCAGTAATGCTGG - Intronic
1160702331 19:513733-513755 CAGTAGGTACTCAGTAATGCTGG - Intronic
1160702335 19:513765-513787 CAGTAGGTACTCAGTAATGCTGG - Intronic
1160702340 19:513798-513820 CAGTAGGTGCTCAGTAAATGTGG - Intronic
1160702355 19:513896-513918 CAGTAGGTGCTCAGTAATGCTGG - Intronic
1160702357 19:513928-513950 CAGCAGGTGCTCAGTAATGCAGG - Intronic
1160702375 19:514036-514058 CAGTGGGTGCTCAGTAATGCTGG - Intronic
1160702389 19:514134-514156 CAGTGGGTGCTCAGTAATACAGG - Intronic
1160702403 19:514232-514254 CGGTAGGTACTCAGTAATGCTGG - Intronic
1160702413 19:514297-514319 CAGTGGGTGCTCAGTAATACAGG - Intronic
1160702429 19:514395-514417 CAATAGGTACTCAGTAATGCTGG - Intronic
1160702438 19:514460-514482 CAGTAGGTGCTCAGTGATGCTGG - Intronic
1160702442 19:514492-514514 CAGCAGGTGCTCAGTAATGCAGG - Intronic
1160912811 19:1482646-1482668 CAGTAGGTGTGCAGTCACCCGGG - Intronic
1160912818 19:1482696-1482718 CAGTAGGTGTGCGGTAACACGGG - Intronic
1162885910 19:13696973-13696995 CAACAGGGGTTCAGTCATGCTGG + Intergenic
1165059551 19:33198445-33198467 CTGCAGGTGGTCAGTAATGCTGG - Intronic
1166147512 19:40847822-40847844 CACCAGGTGTTCAGGTATGCAGG + Intronic
1166151658 19:40879707-40879729 CACCAGGTGTTCAGGCATGCAGG + Intronic
1166170546 19:41025207-41025229 CACCAGGTGTTCAGGTATGCAGG + Intergenic
1166178518 19:41090938-41090960 CACCAGGTGTTCAGGTATGCAGG - Intronic
1168058234 19:53875447-53875469 CAGTGGGTGTTCTGTAAGCCTGG - Exonic
928396922 2:30949734-30949756 TAGTAGGTGCTCAGGAGTGCTGG - Intronic
928536412 2:32245841-32245863 CTGTATGTGTTCAATAATGTTGG + Intronic
930358585 2:50349458-50349480 CAGTATGTTTTCAGGACTGCAGG + Intronic
933033819 2:77366945-77366967 CAGAAGGAGTTCATTAATGAAGG - Intronic
934667227 2:96180835-96180857 CAGTAGATGCTCAATAATGGTGG + Intergenic
936704572 2:115056936-115056958 CAGTATGTGTTCACAAATGAAGG + Intronic
939816822 2:146906664-146906686 CAGTAGGTGGTAAGTCAGGCTGG - Intergenic
940051034 2:149464977-149464999 CATTAGGTGTGAGGTAATGCTGG + Intronic
941349632 2:164415654-164415676 CAGTAGGAGTTCAATAAGACAGG + Intergenic
942528761 2:176885725-176885747 TAGTAGGTGCTCAATAAAGCTGG - Intergenic
943392911 2:187292661-187292683 CAGTTGTTATTCAGTAATTCTGG + Intergenic
945122485 2:206471626-206471648 TAGTGGGTGTTCAATAATTCTGG + Intronic
946666700 2:222058112-222058134 CAGTAGGACTTCAGTACTCCTGG - Intergenic
946708893 2:222486276-222486298 CAGGAGATGGTCAGGAATGCTGG - Intronic
1171820239 20:29829510-29829532 CAATAGATGATCAGTAATGGTGG - Intergenic
1171822527 20:29866669-29866691 CAATAGATGATCAGTAATGGTGG - Intergenic
1171897597 20:30823643-30823665 CAATAGATGATCAGTAATGGTGG + Intergenic
1174262778 20:49308715-49308737 CAGTTGTTGTTCAGTAGTGGAGG - Intergenic
1175033426 20:55977170-55977192 TAGTAGGTATTCAGAAATGGTGG - Intergenic
1180324239 22:11354214-11354236 CAGTAGATGATCAGTAATGGTGG - Intergenic
1183347593 22:37316519-37316541 CAGCGTGTGTTCAGTACTGCAGG - Intergenic
949414083 3:3798548-3798570 CAGAAGTTGTTCAGTACTGAGGG + Intronic
950006026 3:9691496-9691518 CCCTAGTTGTTCAGCAATGCTGG - Intronic
956189123 3:66591779-66591801 CACTGAGTGTTCAGCAATGCTGG + Intergenic
957231863 3:77529378-77529400 CAGTAGGTGTTAAAAAATACAGG + Intronic
960965665 3:123103023-123103045 CAGCAGTTGTCCAGTAAGGCAGG + Intronic
961127307 3:124431301-124431323 AAGCAGTTGTTCAATAATGCTGG + Intronic
963496934 3:146076340-146076362 AACTAGGTGTTCATTAATGGTGG - Intronic
963768413 3:149363114-149363136 TAGTAGGTGCTCAGTAATCCGGG - Intergenic
963960797 3:151306556-151306578 AAGTAGCTGTTCAGTAGTCCTGG - Intronic
966952429 3:184834008-184834030 AAGTAGGTGCTCAGTAATGTTGG + Intronic
966988616 3:185205701-185205723 CAGTAGGTTGGCAGTAAGGCAGG - Intronic
967552433 3:190812258-190812280 GGGTAGGTGCTCAGTAATACGGG + Intergenic
967861891 3:194158746-194158768 CAGTAGGTGCTCAGTAAGTTTGG - Intergenic
967992106 3:195139137-195139159 CAGCAGGTGCTCAGGAAAGCTGG + Intronic
970911686 4:21284352-21284374 AAGTAAGTGTTCAGTAAAGGCGG - Intronic
974094982 4:57353054-57353076 GAGAAGGTGTTCAGTCCTGCTGG + Intergenic
974201813 4:58651969-58651991 TAGAAGGTGTTTAGTTATGCTGG + Intergenic
974786110 4:66621393-66621415 CAGTAGGTATCCTGTAAGGCTGG - Intergenic
975397084 4:73888248-73888270 CAGCAAGGGTTTAGTAATGCTGG - Intergenic
977851513 4:101835828-101835850 CAGTATGTCTACACTAATGCTGG - Intronic
978763488 4:112380371-112380393 CAGTAGATGCTCAGTAGTCCTGG + Intronic
979194405 4:117903160-117903182 CAGTAGGTTTTGAGTAAGGCAGG - Intergenic
981815086 4:148821480-148821502 CAGTAGGTTTTGAGTAAAGTAGG + Intergenic
988716989 5:33837874-33837896 CAGTACGTTTTCAGAAAGGCAGG - Intronic
991224560 5:64255183-64255205 AAGAAAGTGTTCAGAAATGCTGG - Intronic
992890178 5:81196655-81196677 CAGTAGGTACTCACTAATGCCGG + Intronic
993593983 5:89829652-89829674 CAGCAGGTCTTCAGTGATGAGGG - Intergenic
999398970 5:151249854-151249876 CAGTAGGTCTTCAGTGGTGGAGG - Intronic
1001156946 5:169280713-169280735 CAGTGGCTGTTCTGTGATGCTGG + Intronic
1004900072 6:20185394-20185416 CAGTAGAATTTCAGTAAGGCAGG + Intronic
1005119538 6:22374600-22374622 TAATAGGTGTTCACAAATGCAGG + Intergenic
1005811767 6:29521180-29521202 CAGTAGATGCTCTGTGATGCTGG - Intergenic
1008928637 6:56914035-56914057 CAGTGGCTGTTCAGTAAGCCAGG + Intronic
1013727783 6:113121119-113121141 CAGAAGATCTTCAGTTATGCTGG - Intergenic
1016363915 6:143295434-143295456 CAGCAGGGGTCCGGTAATGCAGG - Intronic
1016814747 6:148293199-148293221 CTGTAGGTGCTCAGTGCTGCTGG + Intronic
1021262306 7:18473141-18473163 GAATGGGTGTTAAGTAATGCTGG - Intronic
1022943396 7:35259701-35259723 GAGTAGGTGCTGTGTAATGCTGG - Intergenic
1024991742 7:55240103-55240125 CCGCAGGTGTTCAGTCTTGCCGG + Intronic
1028755496 7:94428824-94428846 CAGTAGGCATTCAGTAAAGTTGG - Intronic
1028961341 7:96752586-96752608 TAGTAGGTGTTCAATTAGGCTGG + Intergenic
1032664160 7:134018451-134018473 CAAAGGGTGTTCAGTAAAGCAGG - Intronic
1035897308 8:3417886-3417908 CATATGGTTTTCAGTAATGCCGG - Intronic
1038707277 8:29906327-29906349 CAGTAGATTTTGAGTAATGCAGG - Intergenic
1038778889 8:30554326-30554348 CTGTGGGTGTTGAGAAATGCTGG - Intronic
1039312365 8:36331054-36331076 CAGTAGGTGTTCAGGAACATGGG - Intergenic
1040773099 8:51003130-51003152 CAGTAGGTATTTAGTTATGAAGG + Intergenic
1046338019 8:112814843-112814865 CAATAGGTCTTAAGGAATGCAGG - Intronic
1047037704 8:120957161-120957183 CTGAAGGTGTTCAGGAATCCTGG + Intergenic
1048308241 8:133298127-133298149 CAGTAGGGGTTGAGAATTGCTGG - Intronic
1050658690 9:7858649-7858671 CAGTAAGTGCTCAGAAATACAGG + Intronic
1053011678 9:34637312-34637334 CAGTGGGTGTTCGTGAATGCGGG - Exonic
1053750164 9:41245456-41245478 CAATAGATGATCAGTAATGGTGG + Intergenic
1054255663 9:62809795-62809817 CAATAGATGATCAGTAATGGTGG + Intergenic
1054335649 9:63805812-63805834 CAATAGATGATCAGTAATGGTGG - Intergenic
1057495556 9:95557874-95557896 CAGTAGGAGCTCAGTTGTGCTGG + Intergenic
1058067726 9:100567572-100567594 CAGTAGGTGCTCAATAATTGTGG + Intronic
1058900746 9:109440109-109440131 CAGTAGGTGCTCAGAAATTTGGG + Intronic
1061404041 9:130383826-130383848 CAGTAAGTGCTCAGTAATGGTGG - Intronic
1062008750 9:134255957-134255979 CAGTAGGGACTCAGAAATGCTGG + Intergenic
1203371899 Un_KI270442v1:314786-314808 CAATAGATGATCAGTAATGATGG - Intergenic
1203375584 Un_KI270442v1:373294-373316 CAATAGATGATCAGTAATGATGG - Intergenic
1187095237 X:16141104-16141126 CAGTAGGTGTTCAAACATCCTGG - Intronic
1188028826 X:25241176-25241198 CAGTAGGTATTCAGTAATGTTGG + Intergenic
1189895398 X:45650231-45650253 TGGTAGGTCTTAAGTAATGCAGG + Intergenic
1190170824 X:48110288-48110310 CAGTAGGGCTTCAGTGATGCTGG - Intergenic
1190217715 X:48491067-48491089 CAGTACGTGTGAAGTTATGCAGG + Intergenic
1191671270 X:63751004-63751026 CAGTGGGTGCTCAGTGATACAGG + Intronic
1198135927 X:133750149-133750171 CAAGAGGTGCTCAGTGATGCAGG - Intronic
1201761431 Y:17543548-17543570 CAGTTGATGATCAGTAATGGTGG - Intergenic
1201840121 Y:18362442-18362464 CAGTTGATGATCAGTAATGGTGG + Intergenic