ID: 1160704166

View in Genome Browser
Species Human (GRCh38)
Location 19:521846-521868
Sequence TCTTGGGACCCTCCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704166_1160704175 27 Left 1160704166 19:521846-521868 CCTCTTTGGGGAGGGTCCCAAGA No data
Right 1160704175 19:521896-521918 CTCTGCAGCCCAGAGGAGGGCGG No data
1160704166_1160704172 20 Left 1160704166 19:521846-521868 CCTCTTTGGGGAGGGTCCCAAGA No data
Right 1160704172 19:521889-521911 ATTAGAGCTCTGCAGCCCAGAGG No data
1160704166_1160704168 -7 Left 1160704166 19:521846-521868 CCTCTTTGGGGAGGGTCCCAAGA No data
Right 1160704168 19:521862-521884 CCCAAGACCCGTAATCGAAAAGG No data
1160704166_1160704176 28 Left 1160704166 19:521846-521868 CCTCTTTGGGGAGGGTCCCAAGA No data
Right 1160704176 19:521897-521919 TCTGCAGCCCAGAGGAGGGCGGG No data
1160704166_1160704174 24 Left 1160704166 19:521846-521868 CCTCTTTGGGGAGGGTCCCAAGA No data
Right 1160704174 19:521893-521915 GAGCTCTGCAGCCCAGAGGAGGG No data
1160704166_1160704173 23 Left 1160704166 19:521846-521868 CCTCTTTGGGGAGGGTCCCAAGA No data
Right 1160704173 19:521892-521914 AGAGCTCTGCAGCCCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704166 Original CRISPR TCTTGGGACCCTCCCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr