ID: 1160704288

View in Genome Browser
Species Human (GRCh38)
Location 19:522710-522732
Sequence CCAGTTTCCCAGCACTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704284_1160704288 -10 Left 1160704284 19:522697-522719 CCACTCCTGTCTCCCAGTTTCCC No data
Right 1160704288 19:522710-522732 CCAGTTTCCCAGCACTGAGCTGG No data
1160704283_1160704288 5 Left 1160704283 19:522682-522704 CCACGATGGCAGAGACCACTCCT No data
Right 1160704288 19:522710-522732 CCAGTTTCCCAGCACTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704288 Original CRISPR CCAGTTTCCCAGCACTGAGC TGG Intergenic
No off target data available for this crispr