ID: 1160704772

View in Genome Browser
Species Human (GRCh38)
Location 19:524763-524785
Sequence TTGGCTGGACCAGCCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704772_1160704778 -6 Left 1160704772 19:524763-524785 CCGCCCCCGGCTGGTCCAGCCAA No data
Right 1160704778 19:524780-524802 AGCCAACACCCTCGCCCACCTGG No data
1160704772_1160704791 25 Left 1160704772 19:524763-524785 CCGCCCCCGGCTGGTCCAGCCAA No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704772_1160704789 21 Left 1160704772 19:524763-524785 CCGCCCCCGGCTGGTCCAGCCAA No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704772 Original CRISPR TTGGCTGGACCAGCCGGGGG CGG (reversed) Intergenic
No off target data available for this crispr