ID: 1160704779

View in Genome Browser
Species Human (GRCh38)
Location 19:524782-524804
Sequence GTCCAGGTGGGCGAGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704779_1160704791 6 Left 1160704779 19:524782-524804 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704779_1160704789 2 Left 1160704779 19:524782-524804 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704779 Original CRISPR GTCCAGGTGGGCGAGGGTGT TGG (reversed) Intergenic