ID: 1160704779 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:524782-524804 |
Sequence | GTCCAGGTGGGCGAGGGTGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160704779_1160704789 | 2 | Left | 1160704779 | 19:524782-524804 | CCAACACCCTCGCCCACCTGGAC | No data | ||
Right | 1160704789 | 19:524807-524829 | CCAGCCCTTCACCACGCCCCCGG | No data | ||||
1160704779_1160704791 | 6 | Left | 1160704779 | 19:524782-524804 | CCAACACCCTCGCCCACCTGGAC | No data | ||
Right | 1160704791 | 19:524811-524833 | CCCTTCACCACGCCCCCGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160704779 | Original CRISPR | GTCCAGGTGGGCGAGGGTGT TGG (reversed) | Intergenic | ||