ID: 1160704781

View in Genome Browser
Species Human (GRCh38)
Location 19:524789-524811
Sequence GCTGGGGGTCCAGGTGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704781_1160704791 -1 Left 1160704781 19:524789-524811 CCTCGCCCACCTGGACCCCCAGC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704781_1160704789 -5 Left 1160704781 19:524789-524811 CCTCGCCCACCTGGACCCCCAGC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704781_1160704799 25 Left 1160704781 19:524789-524811 CCTCGCCCACCTGGACCCCCAGC No data
Right 1160704799 19:524837-524859 AGCCAACACCCTCTCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704781 Original CRISPR GCTGGGGGTCCAGGTGGGCG AGG (reversed) Intergenic
No off target data available for this crispr