ID: 1160704789

View in Genome Browser
Species Human (GRCh38)
Location 19:524807-524829
Sequence CCAGCCCTTCACCACGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704777_1160704789 6 Left 1160704777 19:524778-524800 CCAGCCAACACCCTCGCCCACCT No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704782_1160704789 -10 Left 1160704782 19:524794-524816 CCCACCTGGACCCCCAGCCCTTC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704771_1160704789 27 Left 1160704771 19:524757-524779 CCTTCACCGCCCCCGGCTGGTCC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704780_1160704789 -4 Left 1160704780 19:524788-524810 CCCTCGCCCACCTGGACCCCCAG No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704773_1160704789 18 Left 1160704773 19:524766-524788 CCCCCGGCTGGTCCAGCCAACAC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704781_1160704789 -5 Left 1160704781 19:524789-524811 CCTCGCCCACCTGGACCCCCAGC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704779_1160704789 2 Left 1160704779 19:524782-524804 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704775_1160704789 16 Left 1160704775 19:524768-524790 CCCGGCTGGTCCAGCCAACACCC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704770_1160704789 28 Left 1160704770 19:524756-524778 CCCTTCACCGCCCCCGGCTGGTC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704774_1160704789 17 Left 1160704774 19:524767-524789 CCCCGGCTGGTCCAGCCAACACC No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704772_1160704789 21 Left 1160704772 19:524763-524785 CCGCCCCCGGCTGGTCCAGCCAA No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data
1160704776_1160704789 15 Left 1160704776 19:524769-524791 CCGGCTGGTCCAGCCAACACCCT No data
Right 1160704789 19:524807-524829 CCAGCCCTTCACCACGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704789 Original CRISPR CCAGCCCTTCACCACGCCCC CGG Intergenic
No off target data available for this crispr