ID: 1160704791

View in Genome Browser
Species Human (GRCh38)
Location 19:524811-524833
Sequence CCCTTCACCACGCCCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704781_1160704791 -1 Left 1160704781 19:524789-524811 CCTCGCCCACCTGGACCCCCAGC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704783_1160704791 -7 Left 1160704783 19:524795-524817 CCACCTGGACCCCCAGCCCTTCA No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704774_1160704791 21 Left 1160704774 19:524767-524789 CCCCGGCTGGTCCAGCCAACACC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704772_1160704791 25 Left 1160704772 19:524763-524785 CCGCCCCCGGCTGGTCCAGCCAA No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704784_1160704791 -10 Left 1160704784 19:524798-524820 CCTGGACCCCCAGCCCTTCACCA No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704782_1160704791 -6 Left 1160704782 19:524794-524816 CCCACCTGGACCCCCAGCCCTTC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704779_1160704791 6 Left 1160704779 19:524782-524804 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704776_1160704791 19 Left 1160704776 19:524769-524791 CCGGCTGGTCCAGCCAACACCCT No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704777_1160704791 10 Left 1160704777 19:524778-524800 CCAGCCAACACCCTCGCCCACCT No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704773_1160704791 22 Left 1160704773 19:524766-524788 CCCCCGGCTGGTCCAGCCAACAC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704780_1160704791 0 Left 1160704780 19:524788-524810 CCCTCGCCCACCTGGACCCCCAG No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data
1160704775_1160704791 20 Left 1160704775 19:524768-524790 CCCGGCTGGTCCAGCCAACACCC No data
Right 1160704791 19:524811-524833 CCCTTCACCACGCCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704791 Original CRISPR CCCTTCACCACGCCCCCGGC TGG Intergenic
No off target data available for this crispr