ID: 1160704821

View in Genome Browser
Species Human (GRCh38)
Location 19:524894-524916
Sequence GTCCAGGTGGGCGAGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160704821_1160704829 0 Left 1160704821 19:524894-524916 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704829 19:524917-524939 CCCCAGCCCTTCACCGCCCCCGG No data
1160704821_1160704832 4 Left 1160704821 19:524894-524916 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704832 19:524921-524943 AGCCCTTCACCGCCCCCGGCTGG No data
1160704821_1160704841 30 Left 1160704821 19:524894-524916 CCAACACCCTCGCCCACCTGGAC No data
Right 1160704841 19:524947-524969 AGCCAACACCCTCTCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160704821 Original CRISPR GTCCAGGTGGGCGAGGGTGT TGG (reversed) Intergenic
No off target data available for this crispr