ID: 1160706495

View in Genome Browser
Species Human (GRCh38)
Location 19:532435-532457
Sequence GCCCACCTCCTCCTTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160706478_1160706495 30 Left 1160706478 19:532382-532404 CCCCGGAGGGGTGGCCGGGGGCC No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706481_1160706495 16 Left 1160706481 19:532396-532418 CCGGGGGCCCTCCCTGTAGCATC No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706490_1160706495 4 Left 1160706490 19:532408-532430 CCTGTAGCATCTGGGCGTGGGGC No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706484_1160706495 9 Left 1160706484 19:532403-532425 CCCTCCCTGTAGCATCTGGGCGT No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706480_1160706495 28 Left 1160706480 19:532384-532406 CCGGAGGGGTGGCCGGGGGCCCT No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706479_1160706495 29 Left 1160706479 19:532383-532405 CCCGGAGGGGTGGCCGGGGGCCC No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706485_1160706495 8 Left 1160706485 19:532404-532426 CCTCCCTGTAGCATCTGGGCGTG No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data
1160706488_1160706495 5 Left 1160706488 19:532407-532429 CCCTGTAGCATCTGGGCGTGGGG No data
Right 1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160706495 Original CRISPR GCCCACCTCCTCCTTGGCGG GGG Intronic