ID: 1160706811

View in Genome Browser
Species Human (GRCh38)
Location 19:533713-533735
Sequence ACCGGATTATCCCCTAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160706811_1160706824 23 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706824 19:533759-533781 GCCTCTAGACATCTGCCACAGGG 0: 1
1: 0
2: 0
3: 6
4: 130
1160706811_1160706817 -1 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706817 19:533735-533757 TTTTCCGGATTTCCCAGGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 138
1160706811_1160706813 -6 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706813 19:533730-533752 TCCGGTTTTCCGGATTTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 55
1160706811_1160706818 0 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706818 19:533736-533758 TTTCCGGATTTCCCAGGGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 183
1160706811_1160706819 1 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706819 19:533737-533759 TTCCGGATTTCCCAGGGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1160706811_1160706816 -2 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706816 19:533734-533756 GTTTTCCGGATTTCCCAGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 135
1160706811_1160706823 22 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706823 19:533758-533780 GGCCTCTAGACATCTGCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1160706811_1160706815 -5 Left 1160706811 19:533713-533735 CCAGCATTAGGGGATAATCCGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1160706815 19:533731-533753 CCGGTTTTCCGGATTTCCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160706811 Original CRISPR ACCGGATTATCCCCTAATGC TGG (reversed) Intronic
920071004 1:203303220-203303242 ACCGGCTTCTCCCCAAATGCTGG - Intergenic
920191645 1:204197585-204197607 ACCTGGTCGTCCCCTAATGCTGG + Intergenic
1079150885 11:17897906-17897928 ACCCCATTAACCCCTAATGTTGG + Intronic
1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG + Intronic
1109078283 13:57865318-57865340 ACTGGATTCTCCCTTAGTGCTGG + Intergenic
1116770480 14:49121647-49121669 ACTGGATCATCCCCTCATGATGG + Intergenic
1118921102 14:70150706-70150728 ACCTGCTTATCCCAAAATGCAGG - Intronic
1137293697 16:47070007-47070029 ACAGGATTCTCCCCAAAGGCAGG - Intergenic
1148934704 17:51155562-51155584 AGCGGATTATCCCATAAAGCTGG - Intronic
1159313896 18:66745710-66745732 ACAGTATAAGCCCCTAATGCTGG + Intergenic
1160706811 19:533713-533735 ACCGGATTATCCCCTAATGCTGG - Intronic
933701059 2:85255747-85255769 AGAGGATACTCCCCTAATGCAGG - Intronic
935601632 2:104928057-104928079 ACCCCAGTATGCCCTAATGCAGG - Intergenic
1175968679 20:62673019-62673041 ACCGGATTGTACCCTAATTTGGG - Intronic
949513855 3:4789570-4789592 TCAGGATTATTCCCTAAAGCTGG - Intronic
966459895 3:180165356-180165378 ACTGGATTTTCCCTTAGTGCTGG - Intergenic
986324642 5:6663126-6663148 ACCTGATTATTCCCTAGAGCTGG - Intronic
986557352 5:9025219-9025241 ACTGGATTATCCCTCACTGCTGG - Intergenic
991245995 5:64508516-64508538 ACTGAATTATCTCCTAATACAGG - Intronic
1006186325 6:32183615-32183637 ACCGGAAAATCCCCTCATCCTGG + Exonic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1038409466 8:27346952-27346974 ACCGCATTATCCCCTGATCTAGG + Intronic
1047890575 8:129303787-129303809 ACCAGATTCTCCCTCAATGCTGG - Intergenic
1056098443 9:83277863-83277885 ACCGGAACATCCCTAAATGCTGG + Intronic
1191774133 X:64793757-64793779 ACTGGATTATCCCTTGGTGCTGG + Intergenic
1195819221 X:108925103-108925125 ATCGGATTTTCCCCTACTGCTGG + Intergenic
1198362050 X:135905145-135905167 AGGAAATTATCCCCTAATGCAGG - Intronic