ID: 1160708258

View in Genome Browser
Species Human (GRCh38)
Location 19:539850-539872
Sequence CGCGCACACCAGGACCTACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 35}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160708258_1160708270 20 Left 1160708258 19:539850-539872 CCTCGTAGGTCCTGGTGTGCGCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1160708270 19:539893-539915 GGGTGTACACGGTGCCCTCCAGG 0: 1
1: 0
2: 3
3: 7
4: 97
1160708258_1160708262 -5 Left 1160708258 19:539850-539872 CCTCGTAGGTCCTGGTGTGCGCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1160708262 19:539868-539890 GCGCGGTGCAGCCCCTCATAGGG 0: 1
1: 0
2: 0
3: 1
4: 38
1160708258_1160708268 9 Left 1160708258 19:539850-539872 CCTCGTAGGTCCTGGTGTGCGCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1160708268 19:539882-539904 CTCATAGGGCCGGGTGTACACGG 0: 1
1: 0
2: 0
3: 3
4: 59
1160708258_1160708263 -1 Left 1160708258 19:539850-539872 CCTCGTAGGTCCTGGTGTGCGCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1160708263 19:539872-539894 GGTGCAGCCCCTCATAGGGCCGG 0: 1
1: 0
2: 1
3: 17
4: 178
1160708258_1160708261 -6 Left 1160708258 19:539850-539872 CCTCGTAGGTCCTGGTGTGCGCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1160708261 19:539867-539889 TGCGCGGTGCAGCCCCTCATAGG 0: 1
1: 0
2: 1
3: 6
4: 53
1160708258_1160708264 0 Left 1160708258 19:539850-539872 CCTCGTAGGTCCTGGTGTGCGCG 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1160708264 19:539873-539895 GTGCAGCCCCTCATAGGGCCGGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160708258 Original CRISPR CGCGCACACCAGGACCTACG AGG (reversed) Intronic
901456466 1:9365890-9365912 TGAGCACACCTGGACCTTCGTGG - Intronic
902049952 1:13555186-13555208 CGAGCACAACAGGAGCTACGAGG + Intergenic
1073509480 10:104034320-104034342 TGCGCACATCAGGACCTGCAGGG + Exonic
1077147516 11:1052679-1052701 CACCCACACCAGGCCCTCCGTGG - Intergenic
1084416209 11:69034209-69034231 CACGGACACCAGGCCCCACGGGG + Intergenic
1088314972 11:108498280-108498302 CGCGCTGACCAGCACCTCCGGGG + Exonic
1094769516 12:33638016-33638038 TGCGAACACCAGGATCTATGGGG + Intergenic
1105750924 13:23421056-23421078 GGTGCACACCAGGTCCTAGGTGG - Intronic
1122605779 14:102946765-102946787 CACGCACCCCAGGAGCAACGGGG + Intronic
1122657662 14:103273286-103273308 CGCGCACACCGGGTCCCCCGCGG + Intergenic
1130963581 15:88681126-88681148 AGCTCACACAAGGACCTACAAGG + Intergenic
1131431785 15:92394034-92394056 CGCGCCCGCCGGGACCCACGCGG - Exonic
1132668607 16:1093731-1093753 CGTGCACACCTGGAACTACAAGG - Exonic
1133511628 16:6463868-6463890 CGCGCCCACCATGACCTAGGAGG + Intronic
1137731590 16:50694071-50694093 AGCCCACACCAGGACCTGCGAGG + Intronic
1141524513 16:84603221-84603243 TGCGCACACCAGCCCCCACGGGG + Intronic
1149479816 17:56993995-56994017 CAAGCACACCAGGACTTCCGTGG - Intronic
1150501670 17:65657038-65657060 GGCAAACACCAGGGCCTACGGGG + Intronic
1151730682 17:75909449-75909471 CTCCCACACCAGCACCTACCAGG + Exonic
1151833399 17:76568983-76569005 CCCGCTCACCAGGACCTCCACGG + Intronic
1152760409 17:82104448-82104470 AGCACACACCAGGACCTGGGAGG - Intronic
1157147316 18:45177068-45177090 TGCACAAACCAGGACCTAAGGGG + Intergenic
1160708258 19:539850-539872 CGCGCACACCAGGACCTACGAGG - Intronic
1160782723 19:884994-885016 CGCGCACAAAAGCACCTGCGGGG + Exonic
1161719542 19:5895338-5895360 CCCACACACCAGGACCTAAAGGG + Intronic
1162727141 19:12696479-12696501 CGCGCAGGCCAAGGCCTACGTGG - Exonic
1167149668 19:47701614-47701636 CCCGCCCATCAAGACCTACGAGG + Exonic
1168521406 19:57053744-57053766 AAGGCACACCAGCACCTACGAGG - Intergenic
1173595629 20:44257169-44257191 CTCGCACACCAGGCCCTTCTCGG - Exonic
1175726564 20:61322536-61322558 TGCACACACCAGGACCCAGGAGG - Intronic
1179209318 21:39312846-39312868 CGAGCACAACAGGAGCTACGAGG - Exonic
962269317 3:133966543-133966565 CCCACAAACCAGGACCTAAGGGG - Intronic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
998350130 5:141494986-141495008 CCCGCACACCAAGACCTCCCTGG - Intronic
1001436812 5:171705555-171705577 CCCGCACACCAGGAGCCATGTGG - Intergenic
1001970349 5:175950234-175950256 CGCCCACATCAGGACCTCCATGG + Intronic
1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG + Intergenic
1032594412 7:133225152-133225174 GGTGCACACCATGTCCTACGTGG + Intergenic
1034398732 7:150847387-150847409 CGCCTGCACCAGGACCTACTGGG - Intronic
1040501475 8:48008727-48008749 CGCGCCCGCCGGAACCTACGGGG - Intronic
1049593020 8:143471226-143471248 CGCGCCCACCAGGCCCTCCAGGG + Intronic
1057257978 9:93566684-93566706 CGCGCGCACCGGGACCTGCGCGG - Intergenic