ID: 1160708837

View in Genome Browser
Species Human (GRCh38)
Location 19:541522-541544
Sequence TGAGGATGACTCTGGCACGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160708833_1160708837 -1 Left 1160708833 19:541500-541522 CCGACAGCTGCTTCGGGGACGAT 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1160708837 19:541522-541544 TGAGGATGACTCTGGCACGGAGG 0: 1
1: 0
2: 0
3: 5
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160708837 Original CRISPR TGAGGATGACTCTGGCACGG AGG Exonic
902527708 1:17070096-17070118 GGAAGAAGGCTCTGGCACGGTGG + Exonic
902620381 1:17647275-17647297 AGAGGATGACACTGGCACTCAGG - Intronic
902627925 1:17687749-17687771 TGAGGCTGCCTCGGGCACGGGGG + Intronic
903407716 1:23112269-23112291 TGAGGATGGATCTGTCATGGTGG - Intronic
903780165 1:25815755-25815777 TGAGGACCACTCTGGCTCTGAGG - Exonic
907238637 1:53068418-53068440 TGTGGATGCCTCCAGCACGGGGG - Intronic
907547488 1:55274873-55274895 GGAGGCTGACTCTGGGAAGGTGG + Intergenic
907941738 1:59094848-59094870 TGAGGTTCACTCTGCCACTGTGG + Intergenic
908078145 1:60543595-60543617 TGTGGATGAGTCTGGGAAGGGGG - Intergenic
908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG + Intergenic
908239240 1:62174893-62174915 TGAGGAGTACTATGGCACGGTGG + Intergenic
912949990 1:114113951-114113973 TGAGGAGAGCCCTGGCACGGGGG - Intronic
915221404 1:154377949-154377971 TAAGGATGAGCCAGGCACGGTGG - Intergenic
917632776 1:176906120-176906142 TGAGAGTGACTCTGGCAGTGAGG + Intronic
920186053 1:204160149-204160171 TGAGGTTGACTCTGGGACTCAGG - Intronic
922879116 1:228966353-228966375 TGAGGAGGGCTCTGGCATGCTGG - Intergenic
923330092 1:232915740-232915762 AGAAGATGACACTGGCAGGGTGG + Intergenic
923473269 1:234310917-234310939 TGAGGATGACTCTTGGGTGGGGG - Intronic
1066314708 10:34232987-34233009 TGAGGATGGGCCGGGCACGGTGG - Intronic
1066339499 10:34516533-34516555 TGAAGATAACTTTGACACGGCGG + Intronic
1067449636 10:46374221-46374243 TGAGGTGGACACTGGCACTGGGG + Intergenic
1067587740 10:47486540-47486562 TGAGGTGGACACTGGCACTGGGG - Intergenic
1067634860 10:47994644-47994666 TGAGGTGGACACTGGCACTGGGG - Intergenic
1069736886 10:70662296-70662318 TGAGGGTGACTCTGCCGCTGGGG + Intergenic
1069824201 10:71245393-71245415 GGAGGCTGAGTCTGGCAGGGGGG + Intronic
1070131830 10:73661387-73661409 TGAGGTGGACACTGGCACTGGGG - Intronic
1070846092 10:79523757-79523779 TGAGGAGGACTCTGGGTCGCCGG + Intergenic
1070927705 10:80236553-80236575 TGAGGAGGACTCTGGGTCGCCGG - Intergenic
1071610255 10:87025390-87025412 TGAGGTGGACACTGGCACTGGGG + Intergenic
1071747907 10:88442748-88442770 TCAGGAGGACTGTGGCAAGGAGG - Intronic
1071796823 10:89016658-89016680 TGAGGATGATTCTGGACCGTGGG - Intergenic
1072742573 10:97918331-97918353 AGAGAATGACTCTTGCACGGAGG - Intronic
1074717247 10:116230958-116230980 TGAGGAGGAATCTGGAAAGGTGG + Intronic
1075901198 10:126043863-126043885 AGAGAATGGTTCTGGCACGGCGG + Intronic
1076322733 10:129595481-129595503 AGAGTATGTCTGTGGCACGGGGG - Intronic
1076477144 10:130760969-130760991 TGAGGATGATCCTGGGAGGGTGG + Intergenic
1076807227 10:132864961-132864983 TGTGCAGGACTCTGGCACTGAGG - Intronic
1078562423 11:12384787-12384809 TGAGCATGATTGTGGAACGGGGG + Intronic
1081487037 11:43538752-43538774 TGGGGGTGCCTCTGGCATGGGGG - Intergenic
1081638261 11:44735157-44735179 TTATGCTGACTCAGGCACGGAGG + Intronic
1084509864 11:69596861-69596883 GGAGGGTGACTCTCGCATGGTGG - Intergenic
1085503565 11:77042585-77042607 TGAGGATCACTGTGGCACCTGGG + Intergenic
1085532989 11:77202724-77202746 TGAGGATGCTTCTGGGGCGGGGG + Intronic
1088645491 11:111913383-111913405 GGAGGATGAGGCTGGCACAGGGG - Intronic
1093379204 12:18471080-18471102 TGAGGGTGACTCTGGTACATTGG - Intronic
1101253281 12:102955658-102955680 TGAGGCTTACTCTGGCTGGGAGG + Intronic
1101510666 12:105389744-105389766 TGAGGATGCCTCTGCCATAGCGG - Intronic
1108493547 13:51003698-51003720 TGAGAATGGCTCTGGCTCTGAGG + Intergenic
1115753682 14:36514135-36514157 TGAGGATGCCCCTGGCGCTGAGG - Intergenic
1116069528 14:40026105-40026127 TAAGGATGACCCTGGGAAGGAGG + Intergenic
1119617347 14:76107557-76107579 TGAGCATGGCTCTGGCCCGTAGG - Intergenic
1120983625 14:90313411-90313433 TGAGGCTGAGCCGGGCACGGTGG - Intronic
1122924441 14:104893158-104893180 CGAGGGTGGCTCTGGCACAGGGG - Intronic
1125759357 15:42086299-42086321 TGATGAGGACTCAGTCACGGAGG - Exonic
1127482128 15:59387400-59387422 TGCGAATGCCTCTGGCAGGGTGG + Intronic
1128892942 15:71347159-71347181 TGAGAATGAGCCGGGCACGGTGG - Intronic
1129427382 15:75473575-75473597 TGAGGGTCAGCCTGGCACGGTGG - Intronic
1130254756 15:82320726-82320748 TGAGATTGACTCTGGCACTATGG + Intergenic
1130600217 15:85269280-85269302 TGAGATTGACTCTGGCACTATGG - Intergenic
1130981375 15:88813956-88813978 TGATGGTGACTCTGGCACATTGG + Intronic
1132382896 15:101378986-101379008 TGAGCATGACTCGGGCAGGCGGG + Intronic
1132478430 16:153880-153902 TGAGGAAGAGCCTGGGACGGGGG - Exonic
1132480515 16:164470-164492 TGAGGAAGAGCCTGGGACGGGGG - Intronic
1134342996 16:13362335-13362357 TGAGGATGACTCGAGCCCAGGGG + Intergenic
1138393175 16:56684691-56684713 TGGGGAAGAGTCTGGCACTGGGG + Intronic
1141974168 16:87503635-87503657 GGATGATGACTCTGGCGAGGAGG + Intergenic
1142817171 17:2435680-2435702 GAAGGAAGACTCTGGCAGGGGGG + Intronic
1142817199 17:2435784-2435806 GGAGGAAGACTCTGGTAGGGGGG + Intronic
1147458799 17:40555359-40555381 TGAGAAGGACGCGGGCACGGTGG + Exonic
1148471938 17:47899739-47899761 TGAGGCTGCCACTGGCACAGGGG + Intronic
1151548374 17:74807116-74807138 TGGGGATGACACTGGCGGGGTGG - Intronic
1152587243 17:81194549-81194571 TGTGGACGACTGTGGCACGTGGG - Intronic
1152921690 17:83069070-83069092 GGAGGGGGACTCTGGCAGGGCGG - Intergenic
1160231364 18:77052100-77052122 GGAGGAAGACTCTGGCTCAGAGG - Intronic
1160708837 19:541522-541544 TGAGGATGACTCTGGCACGGAGG + Exonic
1167110327 19:47456949-47456971 TGAGGACGGCTCTGCCAAGGCGG - Exonic
927908724 2:26881194-26881216 TGAGGATGAGACGGGCACAGAGG - Intronic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
937916855 2:127103543-127103565 GGAGGAAGGCTCTGGCAGGGTGG - Intronic
939635698 2:144580369-144580391 TGAAGGTAACTCTGGCACTGTGG - Intergenic
940598541 2:155826691-155826713 TGAGTATGGCTAAGGCACGGAGG - Intergenic
943397542 2:187358524-187358546 AGAGGATGAATCTAGCAGGGGGG - Intronic
948699728 2:239752042-239752064 TGAGGATGACTCTGCCCAGCTGG + Intergenic
1169287895 20:4324925-4324947 TGAGAATTACTCTGGTAGGGTGG - Intergenic
1174384015 20:50176059-50176081 TGAGGATGTCTCTGGGACTTTGG - Intergenic
1175063680 20:56267002-56267024 TGAAGATGAGTCCGGCACAGTGG - Intergenic
1175190705 20:57210631-57210653 TGAGGATCTCTCTGGCCCTGAGG + Intronic
1175671020 20:60902927-60902949 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1175671036 20:60903014-60903036 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1175671051 20:60903101-60903123 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1175671068 20:60903188-60903210 TGAGAATGACTCTTGCCCTGGGG - Intergenic
1179440346 21:41388961-41388983 GAAGGATGACTCTGCCATGGTGG - Intronic
1181876583 22:25945303-25945325 AGAGGGTGACACTGGCACAGTGG - Intronic
1182283243 22:29229940-29229962 TGAGGAAGACTCTGGGAAGCTGG - Intronic
953275177 3:41488845-41488867 ATGGGATGACTCTGGCACAGGGG + Intronic
953619516 3:44521045-44521067 TGAGGATGTCTGTGCCACTGAGG - Intergenic
954037496 3:47859473-47859495 TGAGAATGGCTCTGGCAAGCTGG - Intronic
954413408 3:50381112-50381134 TGAGGATGACAGTGGCTGGGGGG + Exonic
954447218 3:50553241-50553263 TGCCGATGGCTCTGGCACAGGGG + Intergenic
954649169 3:52149753-52149775 TGGGGATGGCTCTGGCACCAGGG + Intronic
955489656 3:59469582-59469604 TGAGCAAGCCTCTGACACGGAGG - Intergenic
958196444 3:90247157-90247179 TGAGGATGATTCTGGTGAGGGGG - Intergenic
959697182 3:109261253-109261275 TGAGAATGAGCCAGGCACGGTGG + Intergenic
962087795 3:132210141-132210163 TGAGTATGACTTAGGCATGGAGG - Intronic
962443799 3:135447592-135447614 TGAGCCTGGCTCTGGCAGGGAGG - Intergenic
973710882 4:53629368-53629390 TTAGGCTGACTCTGGCAAAGAGG + Intronic
977290290 4:95158790-95158812 TGAAGCTGACTGTGGCACAGTGG + Intergenic
977352640 4:95907645-95907667 TGAGGATGACTCTGGACCACAGG - Intergenic
979831419 4:125310233-125310255 TGAGGCGGAGTCTGGCACTGTGG + Intergenic
982466955 4:155743604-155743626 TGAGGATGCCACTGTCATGGAGG + Intergenic
985170451 4:187143385-187143407 TGGGGCTGATTCTGGCACTGGGG - Intergenic
993056370 5:82985176-82985198 TGAGGCAGACACTGTCACGGTGG - Intergenic
995621689 5:114032571-114032593 TCAGAATGACTCTAGCACAGAGG + Intergenic
998553546 5:143101222-143101244 TGAGAATGAGTCTGGCAGGAAGG + Intronic
1001673968 5:173497304-173497326 TGTGGAGGACTCTGGGTCGGGGG + Intergenic
1002399062 5:178981134-178981156 GTAGGATTCCTCTGGCACGGAGG - Exonic
1003030595 6:2597232-2597254 GGAGGCTGACTCTGACATGGGGG - Intergenic
1003696878 6:8415918-8415940 TGAGGATGAAGATGGCACAGTGG + Intronic
1004918358 6:20353438-20353460 TGAGGATGACTCAGGGGCTGGGG - Intergenic
1010581420 6:77601403-77601425 TGAGGAAGACTGTAGCAGGGAGG - Intergenic
1016428834 6:143962063-143962085 AGAGGAGAACTCTGGCAGGGAGG + Intronic
1016993498 6:149945210-149945232 AGAGGATGCCTCTGGCAGGCTGG - Intronic
1017004835 6:150022320-150022342 AGAGGATGCCTCTGGCAGGCTGG + Intronic
1017825417 6:158078039-158078061 GGAGGATGAGTCTGGGACGTGGG + Intronic
1018457410 6:163964369-163964391 TGAGGAAGACTGTGGCACCCAGG - Intergenic
1021102374 7:16598605-16598627 TGTGGAGGACTCTGGCAAGAGGG - Intergenic
1021554160 7:21903030-21903052 TGAGGATTCCTGTGGCACAGCGG + Exonic
1032433177 7:131879679-131879701 TGAGGATGCCTCTGGCACCAGGG + Intergenic
1032448344 7:132003916-132003938 TCAGGAAGACTCTGGCAGGTGGG - Intergenic
1033337904 7:140469037-140469059 TGACTATGACTATGGCACAGTGG + Intronic
1041285017 8:56251993-56252015 TGAGGCTCACTCTGGCCCTGTGG - Intergenic
1041409463 8:57537105-57537127 TGAGGCTGAAACTGGCAGGGAGG - Intergenic
1044650356 8:94487246-94487268 TGAGGATGAGACTTGCATGGTGG + Intergenic
1044930371 8:97246495-97246517 TCAGGATGACTCTGACACTATGG - Intergenic
1045343400 8:101273723-101273745 TGAGGATGACTCAGTGACAGTGG - Intergenic
1048921147 8:139231233-139231255 TGCGGCTGACTGTGGCAAGGAGG + Intergenic
1050658520 9:7856492-7856514 AGAGGAGGACTCTGTCTCGGAGG + Intronic
1052815486 9:33099840-33099862 TCTGGTTGACTCTGGCAAGGGGG + Intergenic
1054878472 9:70121086-70121108 AGAGGATGCCTCTGGCACCGCGG + Intronic
1058649648 9:107163239-107163261 TGAGGAGGACTCTGGGGTGGTGG - Intergenic
1060524441 9:124312497-124312519 TTGGGATGCCTCTGGAACGGGGG - Exonic
1061056577 9:128225915-128225937 AGAGGATGGCACGGGCACGGGGG - Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186746303 X:12573446-12573468 TGAGGAAGTCTCTGGCATGCTGG - Intronic
1187098666 X:16170512-16170534 TGGGGAGGACTCTGGCATGCAGG - Exonic
1197717331 X:129718964-129718986 AGAGGATGGCTCTGGCAGGCGGG - Intergenic