ID: 1160709024

View in Genome Browser
Species Human (GRCh38)
Location 19:542281-542303
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709024_1160709034 16 Left 1160709024 19:542281-542303 CCCCAGCCTGCGGGACAGGGGCG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709024_1160709039 28 Left 1160709024 19:542281-542303 CCCCAGCCTGCGGGACAGGGGCG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 92
1160709024_1160709040 29 Left 1160709024 19:542281-542303 CCCCAGCCTGCGGGACAGGGGCG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709024 Original CRISPR CGCCCCTGTCCCGCAGGCTG GGG (reversed) Intergenic