ID: 1160709025

View in Genome Browser
Species Human (GRCh38)
Location 19:542282-542304
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709025_1160709034 15 Left 1160709025 19:542282-542304 CCCAGCCTGCGGGACAGGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709025_1160709040 28 Left 1160709025 19:542282-542304 CCCAGCCTGCGGGACAGGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data
1160709025_1160709039 27 Left 1160709025 19:542282-542304 CCCAGCCTGCGGGACAGGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709025 Original CRISPR CCGCCCCTGTCCCGCAGGCT GGG (reversed) Intergenic