ID: 1160709027

View in Genome Browser
Species Human (GRCh38)
Location 19:542283-542305
Sequence GCCGCCCCTGTCCCGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709027_1160709034 14 Left 1160709027 19:542283-542305 CCAGCCTGCGGGACAGGGGCGGC 0: 1
1: 0
2: 1
3: 24
4: 316
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709027_1160709039 26 Left 1160709027 19:542283-542305 CCAGCCTGCGGGACAGGGGCGGC 0: 1
1: 0
2: 1
3: 24
4: 316
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709027_1160709040 27 Left 1160709027 19:542283-542305 CCAGCCTGCGGGACAGGGGCGGC 0: 1
1: 0
2: 1
3: 24
4: 316
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709027 Original CRISPR GCCGCCCCTGTCCCGCAGGC TGG (reversed) Intergenic