ID: 1160709028

View in Genome Browser
Species Human (GRCh38)
Location 19:542287-542309
Sequence TCTGGCCGCCCCTGTCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709028_1160709041 27 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709028_1160709034 10 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709028_1160709043 28 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709028_1160709039 22 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709028_1160709040 23 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709028 Original CRISPR TCTGGCCGCCCCTGTCCCGC AGG (reversed) Intergenic