ID: 1160709029

View in Genome Browser
Species Human (GRCh38)
Location 19:542305-542327
Sequence GAGGAACTCTGGGGGCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709029_1160709039 4 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709029_1160709041 9 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709029_1160709040 5 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data
1160709029_1160709034 -8 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709029_1160709044 25 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709029_1160709043 10 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709029 Original CRISPR GAGGAACTCTGGGGGCTTTC TGG (reversed) Intergenic