ID: 1160709030

View in Genome Browser
Species Human (GRCh38)
Location 19:542313-542335
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709030_1160709039 -4 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709030_1160709043 2 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709030_1160709040 -3 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data
1160709030_1160709044 17 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709030_1160709041 1 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709030 Original CRISPR ACAGGGAGGAGGAACTCTGG GGG (reversed) Intergenic