ID: 1160709032

View in Genome Browser
Species Human (GRCh38)
Location 19:542315-542337
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709032_1160709041 -1 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709032_1160709044 15 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709032_1160709039 -6 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 92
1160709032_1160709043 0 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG 0: 1
1: 0
2: 1
3: 9
4: 98
1160709032_1160709040 -5 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709040 19:542333-542355 TGTGACCAGGTGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709032 Original CRISPR TCACAGGGAGGAGGAACTCT GGG (reversed) Intergenic