ID: 1160709034

View in Genome Browser
Species Human (GRCh38)
Location 19:542320-542342
Sequence AGTTCCTCCTCCCTGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709024_1160709034 16 Left 1160709024 19:542281-542303 CCCCAGCCTGCGGGACAGGGGCG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709029_1160709034 -8 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709023_1160709034 17 Left 1160709023 19:542280-542302 CCCCCAGCCTGCGGGACAGGGGC 0: 1
1: 0
2: 1
3: 65
4: 950
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709027_1160709034 14 Left 1160709027 19:542283-542305 CCAGCCTGCGGGACAGGGGCGGC 0: 1
1: 0
2: 1
3: 24
4: 316
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709028_1160709034 10 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709025_1160709034 15 Left 1160709025 19:542282-542304 CCCAGCCTGCGGGACAGGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data
1160709017_1160709034 29 Left 1160709017 19:542268-542290 CCTGGGCAGCATCCCCCAGCCTG 0: 1
1: 0
2: 1
3: 56
4: 562
Right 1160709034 19:542320-542342 AGTTCCTCCTCCCTGTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709034 Original CRISPR AGTTCCTCCTCCCTGTGACC AGG Intergenic