ID: 1160709035

View in Genome Browser
Species Human (GRCh38)
Location 19:542324-542346
Sequence TGCACCTGGTCACAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709035_1160709043 -9 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG 0: 1
1: 0
2: 1
3: 9
4: 98
1160709035_1160709047 30 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709047 19:542377-542399 ATCCAGCAAAGCTTCGTCGCGGG No data
1160709035_1160709046 29 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709035_1160709044 6 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709035_1160709041 -10 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709035 Original CRISPR TGCACCTGGTCACAGGGAGG AGG (reversed) Intergenic