ID: 1160709037

View in Genome Browser
Species Human (GRCh38)
Location 19:542330-542352
Sequence ACTAGATGCACCTGGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709037_1160709044 0 Left 1160709037 19:542330-542352 CCCTGTGACCAGGTGCATCTAGT No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709037_1160709046 23 Left 1160709037 19:542330-542352 CCCTGTGACCAGGTGCATCTAGT No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709037_1160709047 24 Left 1160709037 19:542330-542352 CCCTGTGACCAGGTGCATCTAGT No data
Right 1160709047 19:542377-542399 ATCCAGCAAAGCTTCGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709037 Original CRISPR ACTAGATGCACCTGGTCACA GGG (reversed) Intergenic