ID: 1160709038

View in Genome Browser
Species Human (GRCh38)
Location 19:542331-542353
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709038_1160709046 22 Left 1160709038 19:542331-542353 CCTGTGACCAGGTGCATCTAGTG No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709038_1160709044 -1 Left 1160709038 19:542331-542353 CCTGTGACCAGGTGCATCTAGTG No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709038_1160709047 23 Left 1160709038 19:542331-542353 CCTGTGACCAGGTGCATCTAGTG No data
Right 1160709047 19:542377-542399 ATCCAGCAAAGCTTCGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709038 Original CRISPR CACTAGATGCACCTGGTCAC AGG (reversed) Intergenic