ID: 1160709039

View in Genome Browser
Species Human (GRCh38)
Location 19:542332-542354
Sequence CTGTGACCAGGTGCATCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709032_1160709039 -6 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709031_1160709039 -5 Left 1160709031 19:542314-542336 CCCCAGAGTTCCTCCTCCCTGTG No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709028_1160709039 22 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709029_1160709039 4 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709030_1160709039 -4 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709025_1160709039 27 Left 1160709025 19:542282-542304 CCCAGCCTGCGGGACAGGGGCGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709033_1160709039 -7 Left 1160709033 19:542316-542338 CCAGAGTTCCTCCTCCCTGTGAC No data
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709024_1160709039 28 Left 1160709024 19:542281-542303 CCCCAGCCTGCGGGACAGGGGCG 0: 1
1: 0
2: 1
3: 27
4: 320
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709023_1160709039 29 Left 1160709023 19:542280-542302 CCCCCAGCCTGCGGGACAGGGGC 0: 1
1: 0
2: 1
3: 65
4: 950
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data
1160709027_1160709039 26 Left 1160709027 19:542283-542305 CCAGCCTGCGGGACAGGGGCGGC 0: 1
1: 0
2: 1
3: 24
4: 316
Right 1160709039 19:542332-542354 CTGTGACCAGGTGCATCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709039 Original CRISPR CTGTGACCAGGTGCATCTAG TGG Intergenic