ID: 1160709041

View in Genome Browser
Species Human (GRCh38)
Location 19:542337-542359
Sequence ACCAGGTGCATCTAGTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709030_1160709041 1 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709031_1160709041 0 Left 1160709031 19:542314-542336 CCCCAGAGTTCCTCCTCCCTGTG No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709029_1160709041 9 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709032_1160709041 -1 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709028_1160709041 27 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709033_1160709041 -2 Left 1160709033 19:542316-542338 CCAGAGTTCCTCCTCCCTGTGAC No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data
1160709035_1160709041 -10 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709041 19:542337-542359 ACCAGGTGCATCTAGTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709041 Original CRISPR ACCAGGTGCATCTAGTGGGA CGG Intergenic