ID: 1160709042

View in Genome Browser
Species Human (GRCh38)
Location 19:542338-542360
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709042_1160709044 -8 Left 1160709042 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709042_1160709047 16 Left 1160709042 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
Right 1160709047 19:542377-542399 ATCCAGCAAAGCTTCGTCGCGGG No data
1160709042_1160709046 15 Left 1160709042 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709042 Original CRISPR CCCGTCCCACTAGATGCACC TGG (reversed) Intergenic