ID: 1160709043

View in Genome Browser
Species Human (GRCh38)
Location 19:542338-542360
Sequence CCAGGTGCATCTAGTGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709031_1160709043 1 Left 1160709031 19:542314-542336 CCCCAGAGTTCCTCCTCCCTGTG No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709033_1160709043 -1 Left 1160709033 19:542316-542338 CCAGAGTTCCTCCTCCCTGTGAC No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709035_1160709043 -9 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709030_1160709043 2 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709029_1160709043 10 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709032_1160709043 0 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
1160709028_1160709043 28 Left 1160709028 19:542287-542309 CCTGCGGGACAGGGGCGGCCAGA 0: 1
1: 0
2: 1
3: 20
4: 170
Right 1160709043 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709043 Original CRISPR CCAGGTGCATCTAGTGGGAC GGG Intergenic