ID: 1160709044

View in Genome Browser
Species Human (GRCh38)
Location 19:542353-542375
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709037_1160709044 0 Left 1160709037 19:542330-542352 CCCTGTGACCAGGTGCATCTAGT No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709033_1160709044 14 Left 1160709033 19:542316-542338 CCAGAGTTCCTCCTCCCTGTGAC No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709038_1160709044 -1 Left 1160709038 19:542331-542353 CCTGTGACCAGGTGCATCTAGTG No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709030_1160709044 17 Left 1160709030 19:542313-542335 CCCCCAGAGTTCCTCCTCCCTGT No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709035_1160709044 6 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709042_1160709044 -8 Left 1160709042 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709031_1160709044 16 Left 1160709031 19:542314-542336 CCCCAGAGTTCCTCCTCCCTGTG No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709032_1160709044 15 Left 1160709032 19:542315-542337 CCCAGAGTTCCTCCTCCCTGTGA No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709029_1160709044 25 Left 1160709029 19:542305-542327 CCAGAAAGCCCCCAGAGTTCCTC No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data
1160709036_1160709044 3 Left 1160709036 19:542327-542349 CCTCCCTGTGACCAGGTGCATCT No data
Right 1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709044 Original CRISPR GGGACGGGAGCTGCCTCTGC AGG Intergenic
No off target data available for this crispr