ID: 1160709046

View in Genome Browser
Species Human (GRCh38)
Location 19:542376-542398
Sequence CATCCAGCAAAGCTTCGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160709036_1160709046 26 Left 1160709036 19:542327-542349 CCTCCCTGTGACCAGGTGCATCT No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709035_1160709046 29 Left 1160709035 19:542324-542346 CCTCCTCCCTGTGACCAGGTGCA No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709038_1160709046 22 Left 1160709038 19:542331-542353 CCTGTGACCAGGTGCATCTAGTG No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709042_1160709046 15 Left 1160709042 19:542338-542360 CCAGGTGCATCTAGTGGGACGGG No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data
1160709037_1160709046 23 Left 1160709037 19:542330-542352 CCCTGTGACCAGGTGCATCTAGT No data
Right 1160709046 19:542376-542398 CATCCAGCAAAGCTTCGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160709046 Original CRISPR CATCCAGCAAAGCTTCGTCG CGG Intergenic