ID: 1160711718

View in Genome Browser
Species Human (GRCh38)
Location 19:554889-554911
Sequence TGGTGACTCCCAGAAACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160711718_1160711723 10 Left 1160711718 19:554889-554911 CCTGCGGTTTCTGGGAGTCACCA No data
Right 1160711723 19:554922-554944 CGCAGGACAAGTACACTTTGGGG No data
1160711718_1160711724 13 Left 1160711718 19:554889-554911 CCTGCGGTTTCTGGGAGTCACCA No data
Right 1160711724 19:554925-554947 AGGACAAGTACACTTTGGGGTGG No data
1160711718_1160711721 8 Left 1160711718 19:554889-554911 CCTGCGGTTTCTGGGAGTCACCA No data
Right 1160711721 19:554920-554942 GACGCAGGACAAGTACACTTTGG No data
1160711718_1160711719 -7 Left 1160711718 19:554889-554911 CCTGCGGTTTCTGGGAGTCACCA No data
Right 1160711719 19:554905-554927 GTCACCAGCTCGAACGACGCAGG No data
1160711718_1160711725 23 Left 1160711718 19:554889-554911 CCTGCGGTTTCTGGGAGTCACCA No data
Right 1160711725 19:554935-554957 CACTTTGGGGTGGCACGTCCTGG No data
1160711718_1160711722 9 Left 1160711718 19:554889-554911 CCTGCGGTTTCTGGGAGTCACCA No data
Right 1160711722 19:554921-554943 ACGCAGGACAAGTACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160711718 Original CRISPR TGGTGACTCCCAGAAACCGC AGG (reversed) Intergenic
No off target data available for this crispr