ID: 1160714061

View in Genome Browser
Species Human (GRCh38)
Location 19:567493-567515
Sequence GCTTCCGGGGTGACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160714057_1160714061 -5 Left 1160714057 19:567475-567497 CCGTGCGTAGACTGGTCAGCTTC No data
Right 1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG No data
1160714055_1160714061 12 Left 1160714055 19:567458-567480 CCTTGACGAAGCTTCGGCCGTGC No data
Right 1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160714061 Original CRISPR GCTTCCGGGGTGACTAGAGC AGG Intergenic
No off target data available for this crispr