ID: 1160716251

View in Genome Browser
Species Human (GRCh38)
Location 19:578144-578166
Sequence GGAGGGAAACTGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1544
Summary {0: 2, 1: 1, 2: 11, 3: 140, 4: 1390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160716251_1160716258 -4 Left 1160716251 19:578144-578166 CCCGCCTCCCTCAGTTTCCCTCC 0: 2
1: 1
2: 11
3: 140
4: 1390
Right 1160716258 19:578163-578185 CTCCTGTGCCGCTCGCCTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160716251 Original CRISPR GGAGGGAAACTGAGGGAGGC GGG (reversed) Intronic
900093433 1:930426-930448 TGAGGGAAGGTGTGGGAGGCCGG - Intronic
900389336 1:2427261-2427283 GGAGGGCAGCTGGGGCAGGCAGG + Intronic
900681710 1:3920242-3920264 GGAGGGAAGGGGAGGGAGGGAGG - Intergenic
900764524 1:4494919-4494941 GGATGGGTACTGGGGGAGGCTGG + Intergenic
900840501 1:5045411-5045433 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
900887959 1:5428862-5428884 GGAGGGAGACAGAGGAAGGGAGG + Intergenic
900953739 1:5874383-5874405 GGAGGGACACTGGTGGAGACTGG + Intronic
901158323 1:7155334-7155356 GGAGGGAGCCTGTGGGAGGGAGG + Intronic
901510373 1:9715468-9715490 GGTGGGAGGCTGAGGGAGGGTGG - Intronic
901833325 1:11907219-11907241 TTAGAGAAATTGAGGGAGGCAGG - Intergenic
902223345 1:14980847-14980869 GGAGGAAAAATGAGGGAGGCAGG + Intronic
902458638 1:16554428-16554450 GGAAGGTACCTGAGGGATGCAGG + Intergenic
902493519 1:16853488-16853510 GGAAGGTACCTGAGGGATGCAGG - Intronic
902536208 1:17120426-17120448 GGACAGAAACTGAGGGGGGGTGG + Intergenic
902600813 1:17539489-17539511 GGGGGGAAACTGAGGCCCGCGGG - Intergenic
903027430 1:20439368-20439390 GGAGGGGAGTTGAGGGATGCAGG - Intergenic
903151823 1:21415188-21415210 GGAAGGTACCTGAGGGATGCAGG + Intergenic
903157085 1:21453190-21453212 GGAGGGCACCTGATGGAGCCTGG + Intronic
903181337 1:21606343-21606365 GCAGGGCAACAGAGGGAGGTGGG + Intronic
903193217 1:21668263-21668285 GGAGGGGCACTGAGGGAAGCTGG - Intronic
903274263 1:22210759-22210781 GCAGGGAGACTGGGGGAGGCAGG + Intergenic
903308462 1:22432138-22432160 TGAGGGAAACTGAAAGAGGAAGG + Intergenic
903446007 1:23423667-23423689 GGAGGGAAAAAAAGGGAGCCTGG - Intronic
903503824 1:23818505-23818527 GGAGAGAAACTGGAGAAGGCAGG - Intronic
903891765 1:26574523-26574545 GGAGGGGAACTGAGTCACGCTGG + Intronic
904073107 1:27817033-27817055 GGAAGGAAAGAGAGGGAGGGAGG + Intronic
904389336 1:30171522-30171544 GGAGGGAAACTGGAGGGGGGAGG - Intergenic
904429342 1:30451883-30451905 AGAGAGGAACGGAGGGAGGCTGG - Intergenic
904711360 1:32432925-32432947 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
904756769 1:32772285-32772307 CGAGGGTAACTGGGGGAGGCGGG - Exonic
904810874 1:33162685-33162707 GGAGGGAAAGGGGGGAAGGCAGG + Intronic
905060794 1:35137416-35137438 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
905105540 1:35561449-35561471 GGAGGGAGAGAGAGGGAGGTTGG - Intronic
905313179 1:37064791-37064813 GGAGAGAAACTGAGGCAGAGAGG + Intergenic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905689672 1:39933735-39933757 AGAAGGAATTTGAGGGAGGCAGG - Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
906080633 1:43086097-43086119 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
906152724 1:43597541-43597563 GGAAGGAGAGAGAGGGAGGCAGG + Intronic
906199994 1:43953777-43953799 GGAGGGAAAGTGAATTAGGCAGG + Intronic
906640450 1:47438005-47438027 GGCGGGGGACTGAGGCAGGCAGG - Exonic
906684874 1:47756783-47756805 GGGTGGAAACAGAGAGAGGCAGG - Intergenic
906828222 1:49004681-49004703 TGAGAGAAACAGAGGAAGGCAGG + Intronic
907293386 1:53433154-53433176 GGAGGGATAGTGAGAGAGGTTGG - Intergenic
907454940 1:54569434-54569456 GGAGGGACAGTGAGGGGGCCAGG - Intronic
907520999 1:55023344-55023366 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
908186925 1:61661188-61661210 GGAGGGACCCTGTGGGAGGTGGG - Intergenic
908437770 1:64123087-64123109 GGAGAGATACTGAGGAAGGAAGG - Intronic
908472215 1:64455456-64455478 GGAGGGACCTTGAGGAAGGCTGG + Intergenic
908592333 1:65647405-65647427 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
908750804 1:67421529-67421551 GGAGCGAAACTGAGGGTGTTTGG - Intronic
908852058 1:68386613-68386635 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
908894494 1:68883079-68883101 GGCTGGAAACTGATGGTGGCTGG + Intergenic
909035197 1:70588969-70588991 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
909164120 1:72195967-72195989 TGAGTGAACCTGAGGGAGGAAGG - Intronic
909222903 1:72984843-72984865 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
909223945 1:72992955-72992977 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
909324332 1:74331034-74331056 GGAGGGAAATTGAGGAAATCTGG + Intronic
910003011 1:82359963-82359985 TGAGGGATACTGAGAGAGGTTGG + Intergenic
910700476 1:90068913-90068935 GGAAGGAAAAGGAGGGAGGGAGG - Intergenic
910727675 1:90355878-90355900 GGAGAGAAACTGAGGAAGGAAGG + Intergenic
911188964 1:94928645-94928667 GGATGGAACCTGAAGGAAGCGGG + Intergenic
911309178 1:96272305-96272327 GTAGGGAAAATGGGGGATGCTGG - Intergenic
913163108 1:116163182-116163204 GCAGTGAAGCTGAGGGAGGATGG + Intergenic
913242631 1:116842840-116842862 GGAGGGAAATTGCAGGAGGAAGG + Intergenic
913607013 1:120475938-120475960 GGAAGGTACCTGAGGGATGCAGG - Intergenic
913702053 1:121383291-121383313 GAAAGGAAAGTGAGGGAGGGGGG + Intronic
913988330 1:143585669-143585691 GGAAGGTACCTGAGGGATGCAGG + Intergenic
914042612 1:144063760-144063782 GAAAGGAAAGTGAGGGAGGGGGG + Intergenic
914135475 1:144896728-144896750 GAAAGGAAAGTGAGGGAGGGGGG - Intronic
914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG + Exonic
915076063 1:153308834-153308856 GGAGGGAGGCTGGGGGAGGTGGG - Intronic
915213505 1:154326138-154326160 TGAGGAAAACTGAGGGTGTCAGG + Intronic
915345798 1:155196254-155196276 GGAGGGAAAGGGAGGCAGGAAGG + Intronic
915447343 1:155981482-155981504 AGAGGGAAACAGAGGAAGACAGG + Intronic
915482941 1:156199598-156199620 GGAGGGAAACTGAGTAAGGAAGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916176940 1:162049838-162049860 GGAGGGAAAGAGAGAGAGGAAGG - Intergenic
916528608 1:165634756-165634778 GGAGGGAGAGAGAGGGAGGGAGG - Intronic
916941558 1:169683653-169683675 TGAGGGATAGTGAGAGAGGCTGG - Intronic
917026445 1:170647987-170648009 GGAGGGAAACAGAGGGATATGGG + Intergenic
917104995 1:171483302-171483324 GGAGGGGAAGGGAGGGAGGGAGG + Intergenic
917232913 1:172857159-172857181 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
917598544 1:176553268-176553290 GGAGGGGGGCTGAGGGAGGGAGG + Intronic
917723750 1:177811034-177811056 GGAGGGAAACAGAGGGTGGAGGG + Intergenic
917792728 1:178509703-178509725 GCAGGGAAGCTGAGAGAGACAGG + Intergenic
918346720 1:183613817-183613839 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
918452428 1:184672401-184672423 GGTGGGAGACGGAGGGAGGGAGG + Intergenic
918714675 1:187770570-187770592 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
919111478 1:193225028-193225050 AGGGGGAAACTGTGGGAGGGGGG - Intronic
919476087 1:198035232-198035254 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
919688338 1:200505551-200505573 GGAAGGAAAGTAAGGGAGGGAGG + Intergenic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
919974637 1:202602654-202602676 GCAGGGAAATGGCGGGAGGCTGG + Intronic
920250592 1:204619888-204619910 GCAGGCACACTGAGGGGGGCAGG + Exonic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920489475 1:206402011-206402033 GAAAGGAAAGTGAGGGAGGGGGG + Intronic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920854443 1:209651677-209651699 GCAGGGATTCTGAAGGAGGCTGG + Intronic
920912476 1:210232198-210232220 GGAGGGAAACGGGCGGGGGCGGG + Intergenic
921460057 1:215415037-215415059 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
921519873 1:216146226-216146248 TGAGGGATAGTGAGGGAGGTTGG - Intronic
922053773 1:222020814-222020836 GGAGTTGAACTGAGGGAGGATGG - Intergenic
922202432 1:223417180-223417202 GGAGGGAGAAAGAGGGAGGGAGG + Intergenic
922878520 1:228960780-228960802 GATGGGAAACTGAGGATGGCAGG + Intergenic
923074929 1:230601822-230601844 CGAGGGATAGTGAGGGAGGTTGG - Intergenic
923091553 1:230744967-230744989 GGAGGGCAACCTAGGGAGACAGG - Intergenic
923181877 1:231528032-231528054 GGAGGGAGACGGTGGGAGACGGG + Intergenic
923509809 1:234640699-234640721 AGAGGGAGAGTGAGGGAGGAAGG + Intergenic
923519358 1:234724132-234724154 GGAGGGAGAGGGAGGGAGGAAGG + Intergenic
923544496 1:234914359-234914381 GGAGGCAAAGTGGGGGAGGTGGG - Intergenic
923959132 1:239057078-239057100 GGAGGGAACCCCAGGGAGGGAGG + Intergenic
923962483 1:239101795-239101817 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
924180348 1:241434465-241434487 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
924323752 1:242875014-242875036 GGGCAGAAACTGAGGTAGGCTGG - Intergenic
924581913 1:245330592-245330614 GGAGGGAGAGTGGGGGAGGGAGG + Intronic
924612258 1:245583450-245583472 GGTGGGGAACTGATGGTGGCAGG - Intronic
924741069 1:246794415-246794437 GGAGGAAAGCTGAGAGGGGCTGG + Intergenic
924896302 1:248340504-248340526 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
924953967 1:248909801-248909823 GTAGGGAACCTGAGGGAGACAGG + Intronic
1062771575 10:105258-105280 GGAGGGAGGCAGAGGCAGGCAGG - Intergenic
1062771602 10:105358-105380 GGAGGGAGGCAGAGGCAGGCAGG - Intergenic
1062930539 10:1349597-1349619 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1063362826 10:5471353-5471375 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1063527974 10:6802305-6802327 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1063928479 10:11004654-11004676 GGAGGGTATCTAAAGGAGGCAGG - Intergenic
1064160190 10:12938743-12938765 GGAGGGAAAAAGAGGGTGGGAGG - Intronic
1064367191 10:14718495-14718517 GGAAGGAAAGGGAGGGAGGGAGG + Intronic
1064385147 10:14883831-14883853 GAAGGGTAACTGAGGAAGTCTGG - Intronic
1064778841 10:18810742-18810764 GGAGCGACAGTGAGGGAGGATGG - Intergenic
1065443456 10:25774238-25774260 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1065610307 10:27465939-27465961 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1065698392 10:28401431-28401453 GGAGGTAACATGAGGGAGACAGG + Intergenic
1065916502 10:30358171-30358193 GAAGGGACCCTGGGGGAGGCAGG - Intronic
1066231706 10:33441293-33441315 GCAGAGAAATTGAAGGAGGCAGG - Intergenic
1066362563 10:34745401-34745423 GGAAGGAAAGAGAGGGAGGAAGG + Intronic
1066371537 10:34822017-34822039 GGAGGGAGAGGGAGGGAGGAAGG + Intergenic
1066533871 10:36369257-36369279 AGAGGGAAAGAGAGGGAGGGAGG + Intergenic
1067167452 10:43877115-43877137 GGAGGGTTGCTGAGGGAGGTGGG - Intergenic
1067262501 10:44706584-44706606 GGAGGGAAAATGTAGAAGGCTGG + Intergenic
1067297229 10:44981874-44981896 CTAGGGAAACCGAGGGAGGTTGG + Intronic
1067685339 10:48463507-48463529 GGAGGAAAGGGGAGGGAGGCAGG - Intronic
1067726087 10:48772169-48772191 GGAAGGAGAGTGAGGGAAGCCGG + Intronic
1068558133 10:58481782-58481804 GGAGGGAAAGAGAGGGAAGGAGG - Intergenic
1068688738 10:59894780-59894802 GGAGGGCAACTGAGCCAGGAAGG + Intronic
1068724676 10:60288171-60288193 GGAGGGAAAGTGAGGAGGGTTGG - Intronic
1069054603 10:63831676-63831698 GGAGGGGAACTGCTGGAGACAGG + Intergenic
1069250952 10:66266090-66266112 GGAGAGAAAGAGAGGGAGGAAGG + Intronic
1069321328 10:67175125-67175147 GGAGGGAAAGGGAGGGAGGGAGG + Intronic
1069625905 10:69867522-69867544 GGTGGGAAACTGAGGCAGAAGGG + Intronic
1069754026 10:70762284-70762306 GGAGGGCAACAGGGGGAGGGCGG - Exonic
1069843126 10:71352442-71352464 GGAAGGAAAGGGAGGAAGGCTGG - Intronic
1069913229 10:71772353-71772375 GCAGGGACTCGGAGGGAGGCAGG - Intronic
1070223517 10:74475817-74475839 GGAGGGAGAGGGAGGGAGGGAGG + Intronic
1070694491 10:78551929-78551951 GGAGGGAAGGTGGGGGAAGCAGG + Intergenic
1070707138 10:78647890-78647912 GGAGGGAACCTGGGACAGGCAGG - Intergenic
1070786141 10:79163199-79163221 GGAGGGACGCTGAGGGCAGCAGG - Intronic
1071439319 10:85676452-85676474 TGAGGGAAATAGAGTGAGGCAGG - Intronic
1071718431 10:88119966-88119988 GGAGGGGAACTGAGAGAGAAGGG + Intergenic
1072046943 10:91666690-91666712 GGTGGGGAACTGAGTGTGGCAGG + Intergenic
1073070123 10:100787951-100787973 GGAGGGGCACCGAGGGAGGTGGG + Intronic
1073689128 10:105787914-105787936 GGAGGAAAAATGAGGGAAGGCGG - Intergenic
1074015152 10:109527209-109527231 GGAGGGAGAGGGAGGGAGGTGGG - Intergenic
1074377231 10:112950574-112950596 GGAGGGGAAAAGAGGGAGGAGGG - Exonic
1074389048 10:113041790-113041812 GCTGGGAAATTCAGGGAGGCGGG - Intronic
1074399832 10:113132941-113132963 GGAGGGAGGCAGAGGCAGGCAGG + Intronic
1074721735 10:116271130-116271152 GGAGGGAGCCTGAGTGCGGCGGG + Intronic
1074740491 10:116481258-116481280 TGAGGGATAATGAGGGAGGTTGG - Intergenic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1075248450 10:120845575-120845597 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1075256035 10:120926663-120926685 GGATGGAAACTGAGTGGGGAGGG + Intergenic
1075295641 10:121272583-121272605 ATAGGGAAACTGAGGCATGCAGG - Intergenic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1075802220 10:125160603-125160625 GGAGGGGAGCGGAGGGAGGGTGG - Intronic
1076003358 10:126929550-126929572 GGAGGGAAGCAGAGGGAGAGCGG + Intronic
1076097181 10:127740832-127740854 GGAGGGAGAAGGAAGGAGGCGGG + Exonic
1076104853 10:127813519-127813541 GGAAGGAAAAAGAGGGAGGAAGG + Intergenic
1076187974 10:128463740-128463762 GGAGGGAGGCTGGGGGCGGCAGG + Intergenic
1076203298 10:128574925-128574947 GGAGGGGGCCTGAGGGAGCCAGG + Intergenic
1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG + Intergenic
1076469666 10:130709761-130709783 GGAAGGACAGTGAAGGAGGCTGG + Intergenic
1076550982 10:131278046-131278068 AGATGGAAGCGGAGGGAGGCAGG + Intronic
1076652115 10:131997014-131997036 AGAGTGAAACTGAAGGAGGCTGG + Intergenic
1076874845 10:133210953-133210975 GGAGGGGACCTGGGGGAGTCGGG + Intronic
1076892567 10:133292072-133292094 GGAGGGACACGGAGGGACACGGG - Intronic
1076995543 11:295873-295895 GGACGGAGACTCAGGGAGGGAGG + Exonic
1077078581 11:712547-712569 GGAGGGAGGGTGAGGGAGCCTGG + Intronic
1077163218 11:1122930-1122952 GGAAGGAAAGAGAGGGAGGGTGG - Intergenic
1077191995 11:1259469-1259491 GGAGGATAACTGAGGGGGTCTGG + Intronic
1077304758 11:1864077-1864099 GGAGGGGAAGGGAGGGAGGAGGG + Intronic
1077611892 11:3648482-3648504 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1077705995 11:4486137-4486159 GCAGAGAAACTGTGGGAGGTGGG - Intergenic
1077766686 11:5165508-5165530 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1077881181 11:6351591-6351613 GGATGGAAATTGAGGGAGGGTGG + Intergenic
1077898134 11:6469325-6469347 GGAGGGGAACTGAAGCAGGAAGG - Intronic
1078083878 11:8222198-8222220 AGAGTGAAACTCAGGCAGGCGGG - Intergenic
1078145615 11:8720102-8720124 GGAGGGAGAGAGAGGGAGGGAGG + Intronic
1078145616 11:8720106-8720128 GGAGAGAGAGGGAGGGAGGCAGG + Intronic
1078879829 11:15437144-15437166 GGAGGGAAAGTGGGGAAGGAAGG + Intergenic
1079447209 11:20568488-20568510 GGAGGGATAGTGAGGGAGGTTGG - Intergenic
1079651226 11:22932691-22932713 GCAGGGAAAGAGAGGGAGGAAGG - Intergenic
1080176116 11:29365174-29365196 GGAGGGAGAGAGAGGGAGGGAGG + Intergenic
1080176126 11:29365196-29365218 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
1080176132 11:29365214-29365236 GGAGGGAGAGAGAGGGAGGGAGG + Intergenic
1080176140 11:29365236-29365258 GGAGGGAGAGAGAGGGAGGGAGG + Intergenic
1080176148 11:29365254-29365276 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
1080540194 11:33257625-33257647 GGAAGGAAGATGAGGGAGACGGG + Exonic
1081356557 11:42121272-42121294 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1081489289 11:43554888-43554910 GGAGGGCAAGTGAGGGAGGGAGG + Intergenic
1082028495 11:47589005-47589027 GGAGGGAAGCAGGGGGAGGGAGG + Exonic
1082197980 11:49326281-49326303 TGAGGGATAGTGAGAGAGGCTGG + Intergenic
1083068949 11:59956354-59956376 GGAGGGAAACAAGGGGAGACTGG - Intergenic
1083492598 11:63023915-63023937 GGAGGGAGGCGGAGGGGGGCCGG - Intergenic
1084032040 11:66486920-66486942 GGAGGGAAGGAGAGGAAGGCTGG + Intronic
1084215595 11:67645423-67645445 GAAGGGAAACTGAGGTGGGAAGG + Intronic
1084269021 11:68019405-68019427 AGAGGGAAACTGAGGCTGACAGG - Intronic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084353753 11:68623375-68623397 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1084613578 11:70219558-70219580 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1084742789 11:71150152-71150174 GGAGGGAAGGAGAGGGAGGGAGG + Intronic
1084742807 11:71150198-71150220 GGAGGGAAGGAGAGGGAGGGAGG + Intronic
1084742862 11:71150337-71150359 GGAGGGACAGGGAGGGAGGGAGG + Intronic
1084742886 11:71150399-71150421 GGAGGGACAGGGAGGGAGGAAGG + Intronic
1085059871 11:73435517-73435539 GGAAGGAAAGAGAGGGAGGGAGG - Intronic
1085934051 11:81122690-81122712 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
1087025932 11:93649834-93649856 GGATGGAAACTGAAGCAGGTTGG + Intergenic
1087908883 11:103729876-103729898 GGAGAGAGACAGAGGGAGGAAGG + Intergenic
1088076729 11:105858650-105858672 GGAAGGATAGTGAGGGAGGAGGG - Intronic
1088813263 11:113405531-113405553 GGAGGGAAACTGTGGGTGGCTGG + Intergenic
1089100379 11:115958104-115958126 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
1089187677 11:116631292-116631314 AGAGGGAAGCAGAGGGTGGCTGG - Intergenic
1089399544 11:118156543-118156565 GGAGGGAGAGGGAGGCAGGCGGG - Intergenic
1089559517 11:119336782-119336804 GGAGGAAATGTGAAGGAGGCAGG - Exonic
1089664477 11:120009428-120009450 GGAGGCAAAGGGAGAGAGGCTGG + Intergenic
1089987110 11:122825006-122825028 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1090546765 11:127774303-127774325 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1090659708 11:128872963-128872985 GGGAGGAATCTAAGGGAGGCTGG - Intergenic
1090872218 11:130758490-130758512 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1091137164 11:133202289-133202311 AGAGGGAAAATGATGGAGGATGG - Intronic
1091339839 11:134801699-134801721 GGAGGGGAAGAGAGGGATGCGGG + Intergenic
1091603753 12:1933751-1933773 AGAGGGCACCTGAGAGAGGCAGG + Intergenic
1091638825 12:2218622-2218644 GGAGGGAAATTGAGTTAGGATGG + Intronic
1091913628 12:4251653-4251675 GGAGAGAAAGGGAGGGAGGGAGG + Intergenic
1092069305 12:5619851-5619873 CGAGGGAAACTGGGACAGGCAGG + Intronic
1092287895 12:7140251-7140273 GGGGAGAAACTGAGGGAGTTGGG + Intronic
1092322912 12:7497481-7497503 GGAGGCAAACTGAAGGATGAGGG - Intronic
1092344712 12:7705867-7705889 GGAAGGCAACTGAGGGCTGCGGG + Intergenic
1092350084 12:7749172-7749194 GCAGGGTGACTGTGGGAGGCAGG + Exonic
1092683314 12:11013821-11013843 GGTGGGAAACAGATTGAGGCTGG - Intronic
1092724011 12:11467373-11467395 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1092925092 12:13264922-13264944 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1093071431 12:14709961-14709983 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1093173237 12:15882470-15882492 GGAGGGAAAGGGAGGGAGGGAGG - Exonic
1093439387 12:19176208-19176230 GGAGGAAGACAGAGGGAGGGAGG - Intronic
1093838035 12:23860145-23860167 GGGGGGAAACGGTGGGAGGAGGG + Intronic
1095099282 12:38163689-38163711 GGAGGGAGGCTCTGGGAGGCAGG - Intergenic
1095373815 12:41502510-41502532 GGAGCAAAACTGAGGGAAGAGGG - Intronic
1095379084 12:41567640-41567662 AGAGGTGAACTGTGGGAGGCTGG + Intronic
1095578188 12:43763695-43763717 GGAGGGAAAATGGGGGTGGAGGG - Intronic
1095637447 12:44450639-44450661 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1095926704 12:47585914-47585936 GGAGTGAAAAGGAGGGAGGGAGG - Intergenic
1096310245 12:50514404-50514426 GGAGGGAAGCTGAGGGAGTCTGG - Intronic
1096531104 12:52243355-52243377 GGAGGGAGACTCAGGCTGGCTGG + Intronic
1096657056 12:53098321-53098343 GGTGGGAACTTGGGGGAGGCAGG + Intronic
1097069363 12:56343589-56343611 GCAGGGAAAGGGAGGGAGGATGG + Intronic
1097148123 12:56955616-56955638 AGAGGGAGAGTGAGGGAGACAGG + Intronic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1098006579 12:66003716-66003738 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1098630248 12:72713753-72713775 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1099226278 12:79973175-79973197 AGAGGGAAAGAGAGGGAGGGAGG + Intergenic
1099436294 12:82649780-82649802 GGAGAGAGACTGAGTGAGGGAGG - Intergenic
1099762298 12:86939306-86939328 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1100402840 12:94247152-94247174 TGTGGGAAACGGAGGGAGGAGGG - Intronic
1100505248 12:95213952-95213974 GGAAGGAAAGTGAGGCAGCCAGG - Intronic
1100661740 12:96707132-96707154 GGAAGGAAACTAAGGGAGTGTGG + Intronic
1100935503 12:99660843-99660865 GGTGGGATACAGAGGGAGGTAGG - Intronic
1101066016 12:101021402-101021424 GGAGGGACACTGGAGGAGGAAGG - Intronic
1101316382 12:103632754-103632776 GGCGGGACACGGTGGGAGGCGGG - Intronic
1101693286 12:107101160-107101182 GGAGGGAAACTACAGGAGGAAGG + Intergenic
1101984572 12:109435731-109435753 GCAGGGAAACTGAGGCACGGAGG + Intronic
1101987683 12:109460565-109460587 AGAGGGAAAATGAGGAAGGCAGG + Intronic
1102466510 12:113133730-113133752 CTAGGGAAACTGAGGCAGGGTGG + Intronic
1102535137 12:113575675-113575697 GGAGGGGAACAGTGGGAGCCTGG + Intergenic
1102559189 12:113749963-113749985 GGAAGGCAACTGTTGGAGGCAGG - Intergenic
1104448176 12:128849577-128849599 GGAGGGATGGGGAGGGAGGCAGG - Intergenic
1104847979 12:131856443-131856465 GGAGGGAGACAGAGAGAGACAGG - Intergenic
1104938047 12:132377159-132377181 GGAGGGAGACAGAGAGAGGGAGG + Intergenic
1104956767 12:132470559-132470581 GGAGGGGAAGGGAGGGAGGAGGG + Intergenic
1105452605 13:20513511-20513533 GTAGGGAAACTGAGGCATGGAGG + Intronic
1106592169 13:31107363-31107385 AGAGGGAAACTGAGAGAGAAAGG + Intergenic
1106768685 13:32941163-32941185 GGAGGGAAAGAGATGGGGGCTGG - Intergenic
1106943202 13:34799532-34799554 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1106947038 13:34840167-34840189 GAAGGGACAGGGAGGGAGGCAGG + Intergenic
1107016938 13:35714917-35714939 GGGGGGAAGCTGAGGCAGCCTGG + Intergenic
1107075278 13:36316943-36316965 CGAGGGATAGTGAGGGAGGTTGG - Intronic
1107359631 13:39603901-39603923 GAAGGGAAAGGGAGGGAGGGAGG - Intergenic
1107683418 13:42872508-42872530 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1107746363 13:43514557-43514579 GGGAGGAAACAGAGGAAGGCTGG - Intronic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1107858127 13:44635386-44635408 GTAGGAAAGCTGAGAGAGGCTGG + Intergenic
1107994929 13:45850584-45850606 GGAGGGGAAGTCAGGGAGGTGGG - Intronic
1108242110 13:48475530-48475552 GCAGGGACTCTGAGGGAGGCAGG + Intronic
1108245566 13:48509554-48509576 GGAGGGACAATAATGGAGGCAGG - Intronic
1108794768 13:54017812-54017834 GGAGGGAAAGGGAGGGAGGAAGG + Intergenic
1108794786 13:54017857-54017879 GGAGGGAAAGGGAGGGAGGAAGG + Intergenic
1108804093 13:54132563-54132585 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1108947157 13:56040877-56040899 TGAGGGACAGTGAGGGAGGTTGG - Intergenic
1109030820 13:57184992-57185014 CGGGGGAAACTGAGGGTAGCTGG - Intergenic
1109384456 13:61608504-61608526 GGAGAGAAATAGAGGCAGGCTGG - Intergenic
1109499011 13:63213724-63213746 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
1109717075 13:66231692-66231714 GGAGGGACAGTGAGAGAGGTTGG + Intergenic
1109915344 13:68978054-68978076 GCAGGGAAACAGACAGAGGCTGG - Intergenic
1110369833 13:74727499-74727521 GGAGGGGAAAGGAGGGAGGGAGG + Intergenic
1110388659 13:74945536-74945558 GGAGGGCAACAGAGGCAGGGAGG + Intergenic
1110388686 13:74945605-74945627 GGAGGGCAACGGAGGCAGGGAGG + Intergenic
1110388694 13:74945628-74945650 GGAGGGCAACAGAGGCAGGGAGG + Intergenic
1110388719 13:74945696-74945718 GGAGGGCAACGGAGGCAGGGAGG + Intergenic
1110779642 13:79449966-79449988 GGAAGGAAGGGGAGGGAGGCAGG - Intergenic
1110845047 13:80184135-80184157 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1111126279 13:83913215-83913237 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1111631966 13:90853633-90853655 TGAGGGACAGTGAGAGAGGCTGG + Intergenic
1111913599 13:94338403-94338425 GGAGGCAAGCAGAGGGAGCCAGG - Intronic
1112236553 13:97642889-97642911 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1113309157 13:109113281-109113303 AGAGGGAAGGTGAGGGAGGGAGG + Intronic
1113323987 13:109265695-109265717 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1113557408 13:111249445-111249467 GGAGGGGAAAAAAGGGAGGCTGG + Intronic
1113568832 13:111339116-111339138 GCAGGGAAACCCAGGGTGGCGGG + Intronic
1113885234 13:113655323-113655345 GAAGGGAAACTGAGGCAGAGAGG + Intronic
1113950688 13:114069657-114069679 GCCGGGAAACTGAGGGGGCCGGG + Intronic
1113978728 13:114253027-114253049 TGCGGGAAACTGAGGCAGGATGG + Intronic
1114053971 14:18950114-18950136 TGGGGGAAACGGTGGGAGGCGGG - Intergenic
1114279755 14:21181387-21181409 CGAGGGAAAGGGTGGGAGGCGGG - Intergenic
1114537316 14:23431315-23431337 GGAGAAAAACAGAGGGAGGGAGG + Intronic
1114547453 14:23513162-23513184 GGAGAGAGAGGGAGGGAGGCTGG + Intergenic
1114673577 14:24427572-24427594 GGAGGGTAACTGGGGGTGGGTGG + Exonic
1114854751 14:26424787-26424809 GGAGGGGAACAGAGAGAGGGAGG - Intergenic
1115120017 14:29927716-29927738 GGAGGGAAAATGGCCGAGGCGGG + Exonic
1115240903 14:31250480-31250502 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1115399582 14:32941217-32941239 GGAGGGGAAGGGAGGGAGGGAGG - Intronic
1115399590 14:32941234-32941256 GGAGGGGAAAGGAGGGAGGAGGG - Intronic
1115904501 14:38191259-38191281 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1116179385 14:41516487-41516509 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1116613256 14:47104857-47104879 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1116952632 14:50893786-50893808 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1117344625 14:54820063-54820085 GGAGGGAAGCAGAGAGAGGTGGG - Intergenic
1117403402 14:55378618-55378640 ATAGGGGAACTGAGGGAGGGAGG - Intronic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1117680634 14:58199896-58199918 GGAGGGAAGGATAGGGAGGCCGG + Intronic
1117958197 14:61138559-61138581 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1117977071 14:61309386-61309408 GGAGGGGATCTGTGGCAGGCAGG + Intronic
1118751489 14:68811048-68811070 AGGAGGAGACTGAGGGAGGCAGG - Intergenic
1118893121 14:69925215-69925237 GGAGGGATGCTAAGGGAGGAGGG + Intronic
1118913698 14:70082984-70083006 GGAGGGAAACAGGGGCAGGAAGG + Intronic
1118937597 14:70301341-70301363 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1119022116 14:71124790-71124812 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1119185762 14:72641408-72641430 GGACAGAAACTGAGGCTGGCAGG - Intronic
1119548843 14:75493364-75493386 GCAGGGAATCTGAGGGAGGACGG + Intergenic
1119689603 14:76661256-76661278 AGAGGGAAGCAGAGGGAGACTGG - Intergenic
1119726752 14:76926096-76926118 GGAGGGAGAGAGAGGCAGGCGGG - Intergenic
1119956282 14:78801848-78801870 GGAGGGAAGCTGAAGGATGAAGG - Intronic
1120452287 14:84683691-84683713 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
1120660254 14:87240185-87240207 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1120677926 14:87443482-87443504 GGAAGGAAAGAGAGGGAGGAAGG + Intergenic
1120739781 14:88095318-88095340 GGAGAGAAACAGAGGGAAGATGG - Intergenic
1120829044 14:88981964-88981986 GGAGGGGAACTTAGGCAGACTGG + Intergenic
1120848516 14:89147541-89147563 GGAAGGAAACTGAGGGCACCAGG - Intronic
1121266024 14:92603171-92603193 AGAGGGAGACTCAGGCAGGCTGG + Intronic
1121454396 14:94029014-94029036 GCAAGGAGATTGAGGGAGGCAGG + Intronic
1121618909 14:95332565-95332587 GGAGGGAAAAAGAGGCAGGAAGG - Intergenic
1121703374 14:95973606-95973628 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1121796809 14:96742246-96742268 GGAGGGAGAGGGAGGGAGACAGG - Intergenic
1121827046 14:97018841-97018863 AGAGGGAAACTGAGGGACATTGG + Intergenic
1121880943 14:97499860-97499882 GGAGGGCCTCTCAGGGAGGCAGG - Intergenic
1122040729 14:98985860-98985882 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1122070476 14:99202606-99202628 GGAGGGAGAGAGAGGGAGGCAGG + Intronic
1122234418 14:100323715-100323737 GGAGGCAGAGTCAGGGAGGCTGG + Intronic
1122755257 14:103973566-103973588 GGAGGGTGGATGAGGGAGGCTGG + Intronic
1122862258 14:104587916-104587938 GGAGTCAAGCAGAGGGAGGCGGG + Intronic
1122868483 14:104621838-104621860 GGAGGGAAAGAGAGAGAGGAAGG + Intergenic
1122897445 14:104767269-104767291 TGAGGGAAACTAAGGGACGGGGG + Intronic
1124197752 15:27647693-27647715 GGTGGGAGACAGAGGGAGGGTGG - Intergenic
1124217990 15:27825447-27825469 TGAGGAGCACTGAGGGAGGCAGG + Intronic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1124490360 15:30151475-30151497 GAAGGGACCCTGGGGGAGGCAGG + Intergenic
1124504453 15:30261269-30261291 GGAGGGAAACAGGGCGAGGCTGG - Intergenic
1124576117 15:30909875-30909897 GGAGGCAAACTGAAGCTGGCAGG - Intronic
1124739098 15:32277366-32277388 GGAGGGAAACAGGGCGAGGCTGG + Intergenic
1124753173 15:32386854-32386876 GAAGGGACCCTGGGGGAGGCAGG - Intergenic
1124974912 15:34522554-34522576 GAAGGGACCCTGGGGGAGGCAGG - Intergenic
1125185710 15:36927338-36927360 AGAGAGGATCTGAGGGAGGCAGG + Intronic
1125213428 15:37241055-37241077 TGAGGGATAGTGAGGGAGGCTGG + Intergenic
1126292660 15:47099649-47099671 TGAGGGGATCTGAGGGTGGCTGG - Intergenic
1126336017 15:47587157-47587179 GGAGCAAAGCTGAAGGAGGCAGG + Intronic
1126485946 15:49181052-49181074 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1126725197 15:51624260-51624282 GGAGGGAAGGGGAGGGAGGGGGG - Intergenic
1126835961 15:52665106-52665128 CGAGGGGAATGGAGGGAGGCAGG + Intronic
1126843464 15:52739163-52739185 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1126912649 15:53431834-53431856 TGAGGGATAGTGAGGGAAGCTGG + Intergenic
1127122912 15:55786659-55786681 GGAGGGAAACAGAGAGAAGAAGG + Intergenic
1127254601 15:57278703-57278725 GGAGGGAGAGGGAGGGAGGGAGG - Intronic
1127298976 15:57634193-57634215 TGGGGGAACCTGAGGAAGGCGGG + Intronic
1127446362 15:59067223-59067245 AAAAGGAAACGGAGGGAGGCAGG - Intronic
1127582391 15:60349974-60349996 GGAGGGGAAGGCAGGGAGGCAGG + Intronic
1127582406 15:60350010-60350032 GGAGGGGAAGGCAGGGAGGCAGG + Intronic
1127582421 15:60350046-60350068 GGAGGGGAAGGCAGGGAGGCAGG + Intronic
1127582460 15:60350136-60350158 GGAGGGGAAGGCAGGGAGGCAGG + Intronic
1127679259 15:61276783-61276805 GGAAGTGAACTGAGGGAGGAGGG - Intergenic
1127736158 15:61840833-61840855 GGAAGGAAAGGGAGGGAGGATGG - Intergenic
1127885668 15:63197869-63197891 GTAGGGAAAGAGAGGGAGGGCGG + Intronic
1128059979 15:64729217-64729239 GTGAGGAGACTGAGGGAGGCAGG - Intergenic
1128211541 15:65906683-65906705 AGAGAGAAACAGAGGGAGACAGG + Intronic
1128220958 15:65968203-65968225 GGAGGGAAACTGAGGCAGAAGGG + Intronic
1128231149 15:66036293-66036315 GGAGGGAGAATGAGGGAGCAGGG - Intronic
1128455304 15:67828343-67828365 GAAGGGAAGCTGGGGGCGGCGGG + Intronic
1128501432 15:68229765-68229787 GGAGCGGAGCGGAGGGAGGCGGG + Intronic
1128730520 15:70017720-70017742 GGAGGGAGACTGATGGGGCCTGG + Intergenic
1129239591 15:74243574-74243596 GAAGGGTGACAGAGGGAGGCAGG + Intronic
1129251028 15:74309064-74309086 GGAGGAAGGCTGAGGTAGGCAGG - Intronic
1129440875 15:75579816-75579838 GGAGGGAGAGAGAGGGAGGCAGG - Intergenic
1129664155 15:77570024-77570046 GGAGGGGAGCTGGGGGAGGGAGG + Intergenic
1129732501 15:77940182-77940204 GCAGAGGAACAGAGGGAGGCGGG - Intergenic
1129854013 15:78811473-78811495 GGAGGGAGAGTGAGGGAGGGCGG + Intronic
1130255335 15:82323360-82323382 GGAGGGAAACTGAGGGATATTGG - Intergenic
1130599630 15:85266626-85266648 GGAGGGAAACTGAGGGATATTGG + Intergenic
1130651351 15:85763823-85763845 GGAGGGAAACGTAGGGAGCGGGG + Intronic
1130947758 15:88561614-88561636 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1131278984 15:91005837-91005859 GGATGGCAACTGAGGGAGGGTGG - Intronic
1131338549 15:91573409-91573431 GGAAGGAAAAGGAGGGAGGAAGG + Intergenic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1131683904 15:94751336-94751358 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132118204 15:99153148-99153170 AGACGGAAGCTGAGGGTGGCAGG - Intronic
1132255751 15:100374132-100374154 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
1132340128 15:101073114-101073136 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1132569673 16:638597-638619 GGAGGGGAACTGGGGGAGTGGGG + Intronic
1133089119 16:3389914-3389936 GGAGGGAGACAGAGGGAGTGGGG - Intronic
1133322623 16:4923610-4923632 GGGAGGAAACTGAGGCAGCCTGG + Intronic
1133745889 16:8686395-8686417 GGAGGGATTCAGAGGCAGGCTGG + Intronic
1133749499 16:8713563-8713585 GGAGGGAAGGTGAAGGAGGAGGG - Exonic
1133869894 16:9676624-9676646 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1133941835 16:10315927-10315949 TGAGGAAAACAGTGGGAGGCAGG - Intergenic
1134054771 16:11162990-11163012 GGAGAGGATCTCAGGGAGGCCGG + Intronic
1134342393 16:13357378-13357400 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1134881369 16:17747498-17747520 AGAGGGAAAGGGAGGGAGGCAGG + Intergenic
1135939621 16:26809874-26809896 GGAAGGAAAGAGAGGGAGGAAGG + Intergenic
1136247902 16:28985752-28985774 GGAGGGAGACCCAGGGCGGCTGG - Intronic
1136285559 16:29238432-29238454 GGAGGGAGAGAAAGGGAGGCAGG + Intergenic
1136477377 16:30521911-30521933 GGAAGGAAACCAAGAGAGGCTGG - Exonic
1136560894 16:31038705-31038727 GGAGAGAATCTAAGGGTGGCGGG - Intronic
1137236560 16:46623215-46623237 GGGGGGAAGCAGAGGGAGGTGGG - Intergenic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1137735235 16:50718922-50718944 GGAAGGGAGCTGGGGGAGGCTGG + Intronic
1137764043 16:50963976-50963998 AAAGAGAAACTGAGGGAGACAGG - Intergenic
1138204707 16:55115970-55115992 GCAGGGATACTGAGGCAGGCTGG + Intergenic
1138434428 16:56989299-56989321 GACGGGAAACTGAGGCAGGCGGG - Intergenic
1138603040 16:58068873-58068895 GGAAGGAAAGGGAGGGAGGTAGG + Intergenic
1138607517 16:58098448-58098470 GAAGGGAGACTGAGAGGGGCAGG + Intergenic
1138804610 16:60079161-60079183 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1139039704 16:62984906-62984928 TGAGGGACAGTGAGGGAGGTTGG + Intergenic
1139187924 16:64829030-64829052 GGAGAGAGAGCGAGGGAGGCAGG - Intergenic
1139363663 16:66419390-66419412 GGAGGGAAGGTGAGGGAGGGAGG + Intergenic
1139848195 16:69935185-69935207 GGTGGGACACTCAGGAAGGCAGG - Intronic
1140087351 16:71808876-71808898 GGAGGGATCCTGAGGAAGGAGGG + Exonic
1140161969 16:72505791-72505813 GGAGGGAAACAGTGGTAGCCAGG + Intergenic
1140480702 16:75261443-75261465 GCAGGGCCTCTGAGGGAGGCTGG - Intronic
1140728913 16:77838632-77838654 GGAGGGAAAGGGAAGGAGACAGG - Intronic
1140938408 16:79697594-79697616 GGAAGGAAAAGGAGGGAGGCAGG - Intergenic
1141063729 16:80897696-80897718 GCAGGGAAACTGAGGGACAGGGG + Intergenic
1141472191 16:84246626-84246648 GGAGGGAAACTGAGGGGCTTGGG + Intergenic
1141667692 16:85474403-85474425 GGAGGTGCACGGAGGGAGGCGGG + Intergenic
1141822510 16:86456775-86456797 GGAAGGAAAAGGAGGGAGGGAGG - Intergenic
1141937880 16:87254108-87254130 GGACGGACACTGAAGGAGGGAGG - Intronic
1141983693 16:87565899-87565921 GGAGGGACAGGGAGGAAGGCGGG - Intergenic
1142090892 16:88208586-88208608 GGAGGGAGAGAAAGGGAGGCAGG + Intergenic
1142138519 16:88462283-88462305 GGTGGGGAACTGAGGGAACCAGG - Intronic
1142229952 16:88895499-88895521 GGAGGCAATCTGGGGGAGCCGGG - Intronic
1142319155 16:89369971-89369993 GGATGGAAGCTCAGAGAGGCTGG + Intronic
1142441437 16:90100865-90100887 GGAAGGAAACTGTGGCTGGCTGG - Intergenic
1142644693 17:1304293-1304315 GGAGGGAGACAGAGGGATGGAGG - Intergenic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1142760956 17:2041713-2041735 GGAGGGAAACGCAGGGTCGCAGG + Intronic
1142786964 17:2231899-2231921 AGAGGAAAACAGAGGGAGCCAGG + Intronic
1143461765 17:7108667-7108689 GGAGGGGAAGGGATGGAGGCGGG - Intronic
1143477616 17:7211708-7211730 GGAGGGGGACTGAGGGAAGGGGG + Intronic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1143689040 17:8545140-8545162 GCCGGGAAACTGACCGAGGCTGG + Intronic
1143723973 17:8832937-8832959 GGAGGGACACGTAGAGAGGCTGG - Exonic
1143794798 17:9327894-9327916 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1143913775 17:10274091-10274113 AGAGGGAGGCTGAGGAAGGCTGG - Intergenic
1143965750 17:10755609-10755631 GGAGGGAGAGTGAGGGAGAGAGG - Intergenic
1144031813 17:11329907-11329929 GGAGGGAGAGGGAGGGAGGGAGG - Intronic
1144104347 17:11972363-11972385 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144237770 17:13278664-13278686 AGAGGTAAAATGATGGAGGCAGG + Intergenic
1144278782 17:13703303-13703325 GGGGGGGAAGTGAGGGAGGGGGG + Intergenic
1145268100 17:21390152-21390174 GGAGGGAAGCTGTGAGGGGCAGG - Intronic
1145827864 17:27890922-27890944 GGAGAGGGACTGGGGGAGGCAGG - Intronic
1145843026 17:28012277-28012299 GGAGAGAAACTGAGGGAGAAAGG + Intergenic
1146455290 17:33004814-33004836 GTAGGGAAACTGTGGGAGGTGGG + Intergenic
1147131389 17:38411574-38411596 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
1147316618 17:39623949-39623971 GGAGGGAAAATCTGGGAGGGTGG - Intergenic
1147527099 17:41235991-41236013 GGAAGGGAAGGGAGGGAGGCAGG + Intronic
1147635460 17:41961261-41961283 AGAGGGAAACCAAGGGTGGCAGG + Intronic
1147701912 17:42401588-42401610 GGAGAGAGACAGAGGGAGGGAGG + Intergenic
1147882827 17:43665161-43665183 GGAAGGAATCCGTGGGAGGCTGG + Intergenic
1147897719 17:43761845-43761867 GGAGGGAAAAGGAGGGAAGGAGG - Intergenic
1147957159 17:44142342-44142364 GGAGGGAAACTGAGGCCCGGGGG - Intronic
1147992773 17:44345240-44345262 CAATGGAAACTGAGGTAGGCGGG + Intronic
1148020888 17:44552748-44552770 GGAGGGAATCTGACTGAGTCGGG - Intergenic
1148039443 17:44695037-44695059 GGAGGAGAACTGAAGGAGACTGG + Intergenic
1148150066 17:45391621-45391643 TGAGGGAGACTGATGGAGGATGG + Intergenic
1148616930 17:49007690-49007712 GAAGAGAAAATGAGGGAGACAGG + Intronic
1148733216 17:49850480-49850502 GTGTGGAAACTGAGGCAGGCCGG + Intergenic
1148733838 17:49853411-49853433 GGAGCCAGGCTGAGGGAGGCTGG + Intergenic
1149038414 17:52159030-52159052 GGAGGGTAACAGAGGCAGCCAGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1149662898 17:58344887-58344909 GGAGGGAAACTGGGACTGGCCGG - Intergenic
1149905891 17:60526085-60526107 GGGGGCAAACTGAGGGACGGCGG + Exonic
1150389724 17:64783361-64783383 GAAGAGAAACTGGGGGAGGGAGG - Intergenic
1150519638 17:65852448-65852470 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1150791692 17:68205021-68205043 GGAGGGAAACTTGGGGCGGGGGG - Intergenic
1150863996 17:68830815-68830837 GGAGGAAAACTGGGAGAGTCAGG - Intergenic
1151345812 17:73500562-73500584 GGAGGAGAACAGAGGGAGGATGG - Intronic
1151345862 17:73500780-73500802 GGAGGAGAACGGAGGGAGGATGG - Intronic
1151429802 17:74054836-74054858 AGAGGGAAACAAAGGGAGACAGG - Intergenic
1151451966 17:74203481-74203503 GGAGGGAGGCGGAGGGAGGGCGG + Intergenic
1151606773 17:75142580-75142602 GGAGGGAGAGGGAGGGAGGGAGG + Intronic
1151668021 17:75556679-75556701 GGTGGGGAGCTGAGGGAGGCAGG - Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1151920093 17:77148168-77148190 AAAGGGAAAATGAAGGAGGCGGG + Intronic
1152193525 17:78902901-78902923 GGAAGGAGAGTGAGGGAAGCTGG - Intronic
1152257856 17:79250780-79250802 GGAGGGAAAGGAAGGGAGGGAGG - Intronic
1152291468 17:79442322-79442344 GGAGGGAGAGAGAGGGAGGGAGG + Intronic
1152307479 17:79529731-79529753 GGAGGGAGAGTGAGGAAGGAAGG + Intergenic
1152319584 17:79600984-79601006 GGAGGGGAACAGAGAGAGCCAGG + Intergenic
1152322132 17:79613576-79613598 GGAGAGAAACACAGGGAGACTGG + Intergenic
1152598436 17:81249448-81249470 GGAGGGAAGAGGAGGGAGGAGGG + Intronic
1152598449 17:81249492-81249514 GGAGGGAGAAGGAGGGAGGAGGG + Intronic
1152598454 17:81249509-81249531 GGAGGGAAGAGGAGGGAGGAAGG + Intronic
1152695269 17:81741026-81741048 GGAGGGAGGCTGGGGGAGGGAGG - Intergenic
1152806574 17:82359658-82359680 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806600 17:82359760-82359782 TGAGGGAACCTGAGGGAAGCTGG - Intronic
1152806647 17:82359913-82359935 TGAGGGAAACTGAGGGAAACTGG - Intronic
1152806659 17:82359954-82359976 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806673 17:82360005-82360027 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806691 17:82360055-82360077 TGAGGGAAACTGGGGGAAACTGG - Intronic
1152806705 17:82360096-82360118 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806719 17:82360147-82360169 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806739 17:82360207-82360229 TGAGGGAAACTGGGGGAAACTGG - Intronic
1152806753 17:82360248-82360270 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806762 17:82360278-82360300 TGAGGGAAACTGGGGGAAACTGG - Intronic
1152806774 17:82360308-82360330 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806785 17:82360348-82360370 TGGGGGAAACTGAGGGAAACTGG - Intronic
1152806801 17:82360399-82360421 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806813 17:82360439-82360461 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806825 17:82360480-82360502 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806839 17:82360530-82360552 TGGGGGAAACTGAGGGAAACTGG - Intronic
1152806862 17:82360601-82360623 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806874 17:82360641-82360663 CGAGGGAACCTGAGGGAAACTGG - Intronic
1152806890 17:82360692-82360714 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806927 17:82360814-82360836 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806943 17:82360864-82360886 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806961 17:82360925-82360947 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806973 17:82360965-82360987 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152806981 17:82360995-82361017 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152807001 17:82361065-82361087 TGAGGGAAACTGAGGGAAACTGG - Intronic
1152807027 17:82361175-82361197 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152807042 17:82361225-82361247 TGAGGGAAACTGGGGGAAACTGG - Intronic
1152807055 17:82361266-82361288 TGGGGGAAACTGAGGGAAACTGG - Intronic
1152807068 17:82361306-82361328 TAAGGGAAACTGAGGGAAACTGG - Intronic
1152807094 17:82361416-82361438 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152807103 17:82361446-82361468 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152807116 17:82361496-82361518 TGGGGGAAACTGAGGGAAACTGG - Intronic
1152807130 17:82361536-82361558 TGAGGGAACCTGAGGGAAACTGG - Intronic
1152905934 17:82970971-82970993 GGAGAGAAACCGAGGCAGCCGGG + Intronic
1153230814 18:2933826-2933848 TGCGGGACAGTGAGGGAGGCTGG + Intronic
1153544072 18:6188102-6188124 GGTAGAAAAGTGAGGGAGGCGGG - Intronic
1153618055 18:6952180-6952202 GCTGGGAGACTGAGGAAGGCGGG + Intronic
1154072554 18:11165882-11165904 GCAGGGAAACAGAGGCAGGAAGG + Intergenic
1155058203 18:22204155-22204177 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
1155161735 18:23201814-23201836 GGAGAGAGACTGAGGCAGCCAGG + Intronic
1155251445 18:23956985-23957007 GGAGGGATGCTGAAGAAGGCAGG - Intergenic
1155903951 18:31426845-31426867 GGAGAGAGACTGGGAGAGGCTGG - Intergenic
1156233136 18:35174457-35174479 GGCGGGAAACGGAGAGAGGGAGG - Intergenic
1156556704 18:38076549-38076571 GGTAGGAAGGTGAGGGAGGCAGG - Intergenic
1156915611 18:42462402-42462424 TGAGGGATACTGAGAGAGGCTGG - Intergenic
1156938341 18:42737614-42737636 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1157183882 18:45521829-45521851 GGACTCAAGCTGAGGGAGGCAGG + Intronic
1157335552 18:46734576-46734598 GGAGGGAAAATGGTGGAGGTAGG + Intronic
1157405106 18:47416129-47416151 GGAGGCAACTTGAGGGAGGACGG + Intergenic
1157481894 18:48060489-48060511 GGAGGGAACCAGCAGGAGGCAGG - Intronic
1157512214 18:48284446-48284468 AGAGGGAAAGGGAGGGAGGGAGG + Intronic
1157591135 18:48836998-48837020 GGCAGGAAACTGAGGCAGCCAGG + Intronic
1157599775 18:48886849-48886871 GCAGGGACACTGAGGCAGGCTGG - Intergenic
1157763603 18:50282059-50282081 GCAGGTAAACTGAGGCACGCGGG + Intergenic
1158005041 18:52662544-52662566 GGAAGGAAAGGGAGGGAGGGAGG + Intronic
1158027896 18:52924076-52924098 GAAAGGAAACTGAGGAAGTCAGG + Intronic
1158321648 18:56270512-56270534 GGAGGGAAGGGGAGGGAGGGAGG + Intergenic
1158336068 18:56416060-56416082 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1158394942 18:57071854-57071876 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1158505519 18:58043950-58043972 GGAGGGAAACCGGGAGAGGAGGG + Intergenic
1158848589 18:61470886-61470908 GGAGGGAGAGAGAGGGAGGGAGG - Intronic
1159019945 18:63135247-63135269 GGAAGCAAGTTGAGGGAGGCAGG - Intronic
1159217239 18:65409204-65409226 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
1160187836 18:76689060-76689082 GGAGGGTGAATGAGAGAGGCTGG + Intergenic
1160266362 18:77343113-77343135 GGAGGGAACTTGAGGGGTGCTGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1160793150 19:932323-932345 AGAGGGAAACTGAGGCTGGGCGG + Intronic
1160932532 19:1577419-1577441 GAAGGGAAACCGAGGCAGGGGGG + Exonic
1161073714 19:2275039-2275061 GGAGGAACAGGGAGGGAGGCAGG + Exonic
1161100270 19:2418318-2418340 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1161100343 19:2418500-2418522 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1161100390 19:2418627-2418649 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1161100470 19:2418841-2418863 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1161114505 19:2489161-2489183 GGCGGGCAACAGAGGGAGGCTGG - Intergenic
1161241084 19:3224502-3224524 GGGGGGAAACTGAGGCCGGAAGG - Intergenic
1161270612 19:3387558-3387580 GGAGGGACATGGAGGGGGGCTGG + Intronic
1161661460 19:5549190-5549212 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1161705278 19:5817579-5817601 GGAGGGAAAGAGAGGAAGGAAGG + Intergenic
1162200737 19:9018310-9018332 GGAGGGGAACTGGAGGAGGGTGG - Intergenic
1162483117 19:10941049-10941071 AGAGAGAGACAGAGGGAGGCAGG + Intergenic
1162549588 19:11351103-11351125 GGAGGGGGACTGAGGGATGGTGG + Intronic
1162779292 19:12998307-12998329 AGAGGGAAAGAGAGAGAGGCAGG - Intronic
1163004164 19:14387157-14387179 AGAGGGAAACTGAGGCAGAGAGG + Intronic
1163007655 19:14406634-14406656 GGAGCGGAACGGAGGGCGGCCGG - Intronic
1163026949 19:14518074-14518096 ACAGGGAAACTGAGGCACGCTGG - Intronic
1163426695 19:17244413-17244435 GGCGGCAGACGGAGGGAGGCTGG - Intronic
1163487035 19:17594099-17594121 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1163580446 19:18135703-18135725 GGAGGTAAAATGAGGGAGGGAGG - Intronic
1163685453 19:18709546-18709568 AGAGGGCATCTGAGGGTGGCTGG + Intronic
1163900573 19:20096139-20096161 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1163906752 19:20155139-20155161 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1164051448 19:21587875-21587897 GGAGGGCATTTGAGGGAGGCAGG + Intergenic
1164080592 19:21858677-21858699 GGAGGGATAGTGAGAAAGGCTGG - Intergenic
1164152714 19:22568927-22568949 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1164219119 19:23177556-23177578 GGAGGGATAGTGAGAGAGGTTGG - Intergenic
1164459544 19:28435154-28435176 TGAGGGATATTGAGGGAGGTTGG + Intergenic
1164581607 19:29438645-29438667 GGAGGGAGAATGAGAGAGGGAGG + Intergenic
1164643603 19:29843400-29843422 GGAGGGGAGAGGAGGGAGGCCGG + Intergenic
1164698870 19:30268040-30268062 GGAGAGAAAGGGAGGGAGGCGGG - Intronic
1164734757 19:30532636-30532658 AAAGGGAAGCTGAGGGAGGCCGG + Intronic
1164956650 19:32392281-32392303 AGAGGGAAAGGGAGGGAGGGAGG + Intergenic
1165356593 19:35308134-35308156 GGAGGAGAACTGAGTGAGGCAGG + Intronic
1165788750 19:38478182-38478204 GGAGGGAAAGCAAGGGAAGCAGG - Intronic
1165840754 19:38788106-38788128 GGAAGTAGACTGGGGGAGGCGGG - Intergenic
1165849374 19:38840387-38840409 GGAAGGAAAGAGAGGGAGGACGG + Intronic
1165899646 19:39163123-39163145 GGAGGTAAACTGAGGCAGGGAGG + Intronic
1166010846 19:39941402-39941424 GGTGGGAAATTGAGAGATGCTGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166098357 19:40555524-40555546 GAAAGGAAACTGGGTGAGGCTGG + Intronic
1166111847 19:40627418-40627440 GGAGGGAAACAGAAGGCGGGAGG + Intronic
1166300289 19:41908877-41908899 GGAGGGGAAATGAGGGAGACAGG - Intronic
1166359789 19:42248340-42248362 GGAGGGAAAAGGGAGGAGGCAGG + Exonic
1166543721 19:43622295-43622317 GGAGGGGAACTAAGGGAGAGGGG - Intergenic
1166569499 19:43784783-43784805 GGAGGGGGTCTGAGGGAGGAGGG + Intergenic
1166676687 19:44745528-44745550 GGAGGGAAGGGAAGGGAGGCTGG - Intergenic
1166690991 19:44821097-44821119 GGAGGGAAGGAGAGGGAGGGTGG + Exonic
1166696003 19:44851704-44851726 CCAGTGACACTGAGGGAGGCTGG + Intronic
1166811549 19:45517544-45517566 AGAGTGACACAGAGGGAGGCAGG - Intronic
1166933923 19:46319816-46319838 GGAGGAAGACTGAGGGAAGGGGG - Intronic
1166995145 19:46716510-46716532 GGAGGGGACCTGAGGATGGCGGG + Exonic
1167001930 19:46750631-46750653 GGAGGGAGGCTGAGGCAGGAGGG - Intronic
1167073274 19:47232939-47232961 GGAGGGAAAGTGAAAGAGGGAGG - Intergenic
1167099158 19:47393446-47393468 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1167148511 19:47696090-47696112 GGAGAGAGACTGTGCGAGGCAGG + Intronic
1167206448 19:48105799-48105821 GGAGGGAAGGGGAGGGAGGGAGG - Intronic
1167229814 19:48275248-48275270 GGAGGGAAAAAGAGAGAGGAAGG + Intronic
1167442146 19:49514536-49514558 GCAGGGGAACTGAGGCAGGTGGG - Intronic
1167552869 19:50173133-50173155 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
1167642136 19:50687775-50687797 GGGGAGAAACTGAGGCAGGGAGG - Intronic
1167696825 19:51019785-51019807 AGAGGGAAAGGGAGGGAGCCCGG - Intronic
1167698388 19:51027891-51027913 GAAGGGAAACTGGAGGAGGGAGG - Intronic
1167901875 19:52628367-52628389 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1168051343 19:53832030-53832052 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1168072723 19:53961835-53961857 GGAGGCTGACTGAGGGTGGCTGG + Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168236890 19:55069189-55069211 GGAGGGAGACTGCCGGTGGCCGG - Intronic
1168236976 19:55069587-55069609 AGAGGAAACCTTAGGGAGGCTGG - Intronic
1168310647 19:55458479-55458501 TCTGGGAAGCTGAGGGAGGCAGG + Intronic
1168317788 19:55491567-55491589 GGAGGGAGACTGAGGCAGGGTGG + Intronic
1168336150 19:55598994-55599016 GGAAGGAAACTCATTGAGGCTGG - Intronic
1168357687 19:55712770-55712792 GGTGGGAGAATGAGGGAGGAGGG + Intronic
1168517073 19:57017542-57017564 GGAGGGAAGCAGAGGGAGAAGGG - Intergenic
1168588922 19:57616724-57616746 GGAGGGAAGCTGGGAGTGGCAGG - Intronic
925096342 2:1207480-1207502 GAATGGACACTGAGGGAGGTTGG - Intronic
925222182 2:2150906-2150928 GGAGGGAGACGGAGGGAGGGAGG + Intronic
925466535 2:4111104-4111126 GAAAGGAAACGGAGGGAGGGAGG - Intergenic
925492458 2:4410166-4410188 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
925492464 2:4410184-4410206 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
925518625 2:4714841-4714863 GCAGGGAAAATCAGGGAGGAGGG - Intergenic
925829226 2:7878243-7878265 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
925879791 2:8342851-8342873 AGAGGGAAGCAGAGGGCGGCAGG - Intergenic
925965678 2:9063025-9063047 GAAGGGAAAGGGAGGGAGGGAGG + Intergenic
926001403 2:9336286-9336308 GGAGAGAAAGGGAGGGAGGGAGG - Intronic
926196640 2:10768141-10768163 GGAGGGAATGTGAAGGAGCCTGG + Intronic
926336071 2:11863847-11863869 GTGGGGAGACTGGGGGAGGCGGG - Intergenic
926407463 2:12570283-12570305 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
926413284 2:12626945-12626967 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
927088187 2:19690574-19690596 GGAGGGAGAGAGAGGGAGGGAGG + Intergenic
927199544 2:20569900-20569922 GGAGGGAGACTGTTGGGGGCTGG - Intronic
927486545 2:23492030-23492052 GGAGGGAAAAAGGTGGAGGCAGG - Intronic
927532290 2:23818254-23818276 AGAGGGAGACGGAGGGAGGGAGG + Intronic
927962710 2:27250702-27250724 GGAGGGAGAGAGAGGCAGGCCGG - Intergenic
928096218 2:28406804-28406826 GCAGGGAGGCTGGGGGAGGCTGG - Intronic
928314086 2:30232466-30232488 GGAGGGATGCAGAGAGAGGCAGG + Intronic
928435563 2:31252407-31252429 GGATAGGAACTGAGGAAGGCAGG - Intronic
928631940 2:33202685-33202707 GAAGGGGAACTGAGCCAGGCTGG + Intronic
928827878 2:35441987-35442009 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
928928285 2:36599702-36599724 TGAGGGATAGTGAGGGAAGCTGG - Intronic
929041208 2:37746585-37746607 GGAGGGAGACTGAGCCAGTCAGG - Intergenic
929164339 2:38865992-38866014 GGAGGGAAGAAGAGGGAGGAAGG + Intronic
929327300 2:40631847-40631869 GGAAGGAAAGTTAGGGAAGCAGG - Intergenic
929444558 2:41992083-41992105 GGAGGGAAAGTGGGGGAGAAGGG + Intergenic
929616155 2:43310206-43310228 GGCGGGAAAGGGAGGGAGGGAGG - Intronic
930036067 2:47085988-47086010 GGAGGGGAACAGAGGCAGTCTGG - Intronic
930241353 2:48938610-48938632 GGAGGAAAACTGAGGAACGGCGG - Intergenic
930487583 2:52026989-52027011 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
930724956 2:54673775-54673797 GGAGTGGAAATCAGGGAGGCAGG + Intergenic
930954720 2:57192907-57192929 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
930954834 2:57193670-57193692 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
931026675 2:58118502-58118524 TGAGGGATAGTGAGGGAAGCTGG + Intronic
931236599 2:60418009-60418031 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
931721110 2:65068468-65068490 GGAGGGAAGCTGTGGAAAGCTGG - Intronic
931947964 2:67332090-67332112 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
931996542 2:67844249-67844271 GGAGGGAAAGAGAGGGAGGGAGG - Intergenic
932396812 2:71454252-71454274 AGAGGGAAACTGAGGCTGGAAGG + Intronic
932528236 2:72496617-72496639 GGAGGGGAACAGAGGGAAGGTGG + Intronic
932719858 2:74130991-74131013 GGAGGGGAACTGCGGTGGGCAGG + Intronic
932854483 2:75218882-75218904 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
932863898 2:75321723-75321745 GCAGGGAGGCTGAGGGAGGAGGG - Intergenic
933012785 2:77088850-77088872 TGAGGGATAGTGAGGGAGGTTGG - Intronic
933078995 2:77965742-77965764 GGAGGGATAGTGAGGGAGCTTGG - Intergenic
933329807 2:80879598-80879620 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
933538101 2:83602809-83602831 GGTGGGAAACTCAGGGAACCAGG + Intergenic
933552638 2:83793875-83793897 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
933659874 2:84918702-84918724 GGATGGAAACTGATGTAGGATGG + Intergenic
933708060 2:85306026-85306048 GGTGGGAAACTACGGGAGGAAGG + Intronic
934123654 2:88865288-88865310 GGAAGGAAAGTCAGGGAGGGAGG + Intergenic
934566053 2:95341934-95341956 GGAGGGAAAAGGACGGGGGCGGG + Intronic
934712208 2:96523572-96523594 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
935482735 2:103613426-103613448 GGAGGAACAATGAGAGAGGCAGG + Intergenic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
935635089 2:105243804-105243826 GGAGGAAAACGAAGGGAGGCAGG - Intergenic
935676379 2:105598083-105598105 GGAGGCAGGCAGAGGGAGGCAGG - Intergenic
936086602 2:109473737-109473759 GGAGGTAGCCTGAGGCAGGCAGG - Intronic
936126046 2:109789860-109789882 AGAGGGGAGCTGAGGCAGGCAGG + Intergenic
936218647 2:110581608-110581630 AGAGGGGAGCTGAGGCAGGCAGG - Intergenic
936611345 2:114004973-114004995 AGAGAGAAGCTGAGCGAGGCAGG - Intergenic
936794500 2:116189102-116189124 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
936883072 2:117279379-117279401 TGAGGGATAATGAGGGAGGTTGG - Intergenic
937249615 2:120515232-120515254 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937249620 2:120515249-120515271 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937249625 2:120515266-120515288 GGAGGGAGAATCAGGGAGGAGGG - Intergenic
937249699 2:120515590-120515612 GGAGGGAGAATCAGGGAGGAGGG - Intergenic
937249709 2:120515624-120515646 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937338370 2:121075821-121075843 GGAGAGAAACTGAGGGGGCAGGG - Intergenic
937477709 2:122229798-122229820 TGGGGGAAACTGAGGCATGCAGG - Intergenic
937872030 2:126792810-126792832 CCAGGGAAACAGTGGGAGGCAGG + Intergenic
937931010 2:127205202-127205224 GGACGGAAATTGAGGGACCCTGG + Intronic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938698824 2:133858469-133858491 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
938698834 2:133858491-133858513 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
938732239 2:134155718-134155740 GGCTAGAAACAGAGGGAGGCAGG - Intronic
939202031 2:139048262-139048284 GGAGGGAAAGAGAAGGAGGGGGG + Intergenic
939307193 2:140426977-140426999 TGAGGGATAGTGAGGGAGGTTGG - Intronic
939319901 2:140605647-140605669 GGAAAGAAACGGAGGCAGGCAGG - Intronic
939460954 2:142494747-142494769 TGAGGGATAGTGAGAGAGGCTGG + Intergenic
939491617 2:142883556-142883578 GGAGGGAAAAAGAGGGAAGGAGG - Intronic
939532498 2:143382089-143382111 GGAAGGAAAGGGAGGGAGGAAGG - Intronic
939733812 2:145819166-145819188 GGAGGGAGAGAGAGGGAGGGAGG - Intergenic
940005737 2:149008082-149008104 GGAGGGAATCAGAGGGGAGCGGG - Intronic
940057350 2:149526807-149526829 GCAGGGAAACTGAGGGGGGTGGG - Intergenic
940188853 2:151017218-151017240 GGAGTGAAGCTGAGGCAGGGAGG - Intronic
940529906 2:154867900-154867922 TGAGGGATAGTGAGGAAGGCTGG - Intergenic
941099045 2:161277209-161277231 GGAGGGAAAGAGAGAGAGGGAGG - Intergenic
941340122 2:164296434-164296456 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
941353133 2:164459817-164459839 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
941379514 2:164775934-164775956 GCAGGGAAACTAAGGGAGGAGGG - Intronic
941381849 2:164802836-164802858 GGAGGGAAAGAGAGGGAGGAAGG + Intronic
941456452 2:165715520-165715542 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
941695809 2:168550132-168550154 AGAGAGAGACTGAGGGAGGAAGG - Intronic
941715585 2:168760075-168760097 TGGGGGGATCTGAGGGAGGCTGG - Intronic
941975288 2:171397593-171397615 GGAGGGAAAATGAGCAAAGCAGG + Intronic
942871222 2:180736795-180736817 GTAGGGACACTGAAGGAGGAAGG + Intergenic
943197527 2:184773646-184773668 TGAGGGAAAGAGTGGGAGGCAGG + Intronic
943413205 2:187565500-187565522 TGAGGGATAGTGAGGGAGGTTGG + Intronic
943421865 2:187675621-187675643 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
944407848 2:199405520-199405542 GGAGGGAAATAGAGAAAGGCTGG + Intronic
944576854 2:201098460-201098482 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
944589710 2:201205525-201205547 AGAAGGAAAAAGAGGGAGGCTGG - Intronic
944683342 2:202096575-202096597 AGAGGGAAAGTGAGGCTGGCTGG + Intronic
944862032 2:203824281-203824303 GGAGAGAGAGTGAGGGGGGCGGG + Intergenic
944876415 2:203967080-203967102 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
945053095 2:205843986-205844008 GGAGGGGAAGGGAGGGAGGGAGG + Intergenic
945198097 2:207256120-207256142 GGAGAGAAAAGGAGGGAGGAGGG + Intergenic
945375819 2:209078646-209078668 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
945394058 2:209299966-209299988 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
945511014 2:210702730-210702752 TGAGGGAGACTGAGGCAGGTTGG + Intergenic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
946400387 2:219465410-219465432 GGAGGGGAACTGAGGCAGGGGGG - Intronic
946401895 2:219472619-219472641 GTAGGGAAACTGAGGCAGAGCGG - Intronic
946553061 2:220823770-220823792 GGAAGGAAAGGGAGGGAGGAAGG - Intergenic
946781312 2:223194904-223194926 TGAGGGATAGTGAGGGAGGTTGG + Intronic
946886220 2:224225904-224225926 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
946892983 2:224297218-224297240 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
947279829 2:228438348-228438370 GGAGGGAGAGGGAGGGAGGGAGG - Intergenic
947591381 2:231388128-231388150 AGAAGGAAACTGAGGCAGGTGGG - Intergenic
947654979 2:231819335-231819357 GGAAGGAAACCCAGGGAGGGTGG - Intergenic
947858555 2:233341693-233341715 GGAGGGAAAATGAGAGTGACTGG + Intronic
948267617 2:236647093-236647115 GGAGGGACACTGTGGGGGGTGGG - Intergenic
948293942 2:236847267-236847289 AGAGGGAGCCAGAGGGAGGCAGG + Intergenic
948622109 2:239242223-239242245 GGAGGGGAAGGGAGGGAGGGAGG + Intronic
948830380 2:240595710-240595732 GGGAAGAGACTGAGGGAGGCAGG - Intronic
948855403 2:240727998-240728020 GGAGGGGAGCTGGGTGAGGCTGG - Intronic
1168854768 20:1000987-1001009 GGAAGGAAAATGAGAGAGGATGG - Intronic
1169118756 20:3083232-3083254 GGAGGGGAACGCAGCGAGGCGGG + Intronic
1169216426 20:3796988-3797010 GGAGGCACAATGAGGGAGGAGGG - Intronic
1169342666 20:4808336-4808358 GGAGGGAAACTGAGGCAAGGAGG + Intronic
1169408852 20:5349721-5349743 TGAGGGAACCTGAAGGAGACGGG + Intergenic
1169525997 20:6426319-6426341 GGAGGGAGAGAGAGGGAGGATGG - Intergenic
1170069129 20:12345310-12345332 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1170105940 20:12754450-12754472 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1170545244 20:17430749-17430771 GGATGGAATCTAAGGGAGGCGGG + Intronic
1170646993 20:18206630-18206652 GGAGGGAGGTTGAGGGAGGGAGG + Intergenic
1171005151 20:21457350-21457372 GGAGGGAGACTGAGGTAGGGAGG + Intergenic
1171178976 20:23077568-23077590 GGAGGGAGAGGGAGGGAGGGAGG - Intergenic
1171210886 20:23316114-23316136 TGATGGAAACTGAGGGAGGCTGG - Intergenic
1171405802 20:24911735-24911757 GGAGAGAAAGTGAGTGAGGCGGG + Intergenic
1171436870 20:25130864-25130886 GACTGGAAACTGAGGCAGGCAGG - Intergenic
1171442400 20:25175930-25175952 GGAGGGAAAATGGGGGCTGCGGG + Intergenic
1171779672 20:29408075-29408097 GGCGGGACGCTCAGGGAGGCCGG + Intergenic
1172195271 20:33087253-33087275 GGAGGGAGGCAGAGGGAGGTGGG - Intronic
1172659533 20:36558144-36558166 GGAGAGTATCTGAGGGAGGGAGG + Intergenic
1172805452 20:37608637-37608659 GGTGAGAAAGTGCGGGAGGCAGG - Intergenic
1172932802 20:38598190-38598212 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1173118594 20:40269676-40269698 TGAGGGATAGTGAGGGAAGCTGG - Intergenic
1173285683 20:41669878-41669900 GAAGGGACAAGGAGGGAGGCAGG + Intergenic
1173365582 20:42381675-42381697 GGAGGGAAAATGGGGGAAGAAGG + Intronic
1173427505 20:42955846-42955868 GGAGGGAGAAGGAGGGAGGGAGG + Intronic
1173537688 20:43828557-43828579 GGAGGAAAAGGGAAGGAGGCTGG + Intergenic
1173781363 20:45759927-45759949 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1173865829 20:46312264-46312286 AGAGGGAGACAGAGGGAGACTGG - Intergenic
1174582208 20:51579922-51579944 GGAGGGAAAATGATGGAGTAGGG - Intergenic
1174739635 20:52999393-52999415 GGAGGGAAGGTGAGGGAAGGGGG + Intronic
1175229774 20:57466365-57466387 GGAGGGCAAGTAAGGCAGGCGGG - Intergenic
1175252286 20:57616811-57616833 GGACGGAGCCAGAGGGAGGCAGG + Intronic
1175492183 20:59386753-59386775 GGAGGGAAACTGAGGCACAGAGG - Intergenic
1175524091 20:59621652-59621674 GGAAGGCCACTGAGGCAGGCAGG - Intronic
1175921078 20:62450916-62450938 GGAGGGGACCTGGGGGAGGAAGG - Intergenic
1175922704 20:62457521-62457543 GCAGGGAAGCTGAGGGAGGCAGG - Intergenic
1175939649 20:62532147-62532169 GGAGTGGAGCTGACGGAGGCTGG - Intergenic
1176192927 20:63821882-63821904 GAAGGGAAACTAAGGGAGTCAGG - Intronic
1176270389 20:64233154-64233176 GGAGGGAAAGGGAAGGAGGAAGG - Intronic
1176936166 21:14869482-14869504 GGAGGGACAGAGAGGGAGGGAGG + Intergenic
1177497163 21:21903879-21903901 GGAGGGAAGGGGAGGGAGGGAGG + Intergenic
1178000980 21:28162015-28162037 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1178006606 21:28227400-28227422 AGAGGGAAAGAGAGGGAGGAAGG + Intergenic
1178098439 21:29240308-29240330 GTTGGGAAACTGGGGCAGGCAGG - Intronic
1178140301 21:29675309-29675331 GGAGAGAAACTCAGGCAGCCTGG - Intronic
1178379596 21:32096695-32096717 GGAGGGAAGGAGAGGGAAGCGGG - Intergenic
1178441275 21:32600483-32600505 TGAGGGAAAGTGAAGGACGCGGG - Intronic
1178975011 21:37214007-37214029 GAAGGGAAACGGAGAGAGGGAGG - Intergenic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179150613 21:38805762-38805784 GGAGGGGAAGGGAGGTAGGCAGG - Intronic
1179417820 21:41212505-41212527 GGCAGGAAAGTGAGGTAGGCGGG + Intronic
1179514303 21:41896105-41896127 GGAGGGAACACGAGGCAGGCAGG + Intronic
1179584539 21:42366226-42366248 GGAGAGTAACTCAGGGTGGCAGG - Intronic
1179628871 21:42664656-42664678 GGAGGGAAAGGAAGGGAGGGAGG + Intronic
1179725817 21:43340729-43340751 AGAGGTGAGCTGAGGGAGGCAGG + Intergenic
1179874590 21:44261634-44261656 TGAGGGACACTGTAGGAGGCTGG - Intronic
1179902424 21:44401071-44401093 GGTGGGAAACTGAGGCAGGGAGG + Intronic
1180096697 21:45558661-45558683 GCTGGGAATCTGAGGGAGTCGGG + Intergenic
1180127571 21:45802690-45802712 GGAGAGGCCCTGAGGGAGGCAGG + Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180320005 22:11311157-11311179 GAAGGGAGAGAGAGGGAGGCAGG - Intergenic
1180472442 22:15672495-15672517 TGGGGGAAACGGTGGGAGGCAGG - Intergenic
1180525451 22:16254881-16254903 GGAAAGGAACTGAGGGAGGAAGG + Intergenic
1180560631 22:16611950-16611972 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1180956784 22:19744813-19744835 GGAGGGCAGCTGAAGGAGGGAGG + Intergenic
1181589616 22:23876106-23876128 GGAGGGAGAGAGAGGGAGACAGG + Intronic
1181594012 22:23902758-23902780 GGTGGGAAGCTCAGGGAGGCTGG - Intergenic
1181803644 22:25362369-25362391 CTAGGGAAACGGAGGCAGGCAGG + Exonic
1182113667 22:27742608-27742630 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1182151998 22:28034408-28034430 GGAGGGCAAGAGAGGTAGGCAGG - Intronic
1182266505 22:29120015-29120037 TGAAGGAAACAGAGGGAGGAAGG + Intronic
1182298703 22:29326340-29326362 GCAGGGAAACTGAGGCAGGGAGG - Intergenic
1182899269 22:33884543-33884565 GCAGGGAATCTGTGGGAGACCGG + Intronic
1182932722 22:34190362-34190384 GGAGGGAAACTAAGGGATTATGG + Intergenic
1183380193 22:37486715-37486737 GGAGGGAATGTGGGTGAGGCTGG - Intergenic
1183474190 22:38026859-38026881 GGTAGGAGACTGGGGGAGGCTGG - Intronic
1183524804 22:38316895-38316917 GGGGGGAAGCGGAGGCAGGCCGG + Intronic
1183922790 22:41182640-41182662 TGTGGGAGACTGAGGGAGGAAGG + Intergenic
1184033057 22:41905952-41905974 AGAGAGAAACTCAGGAAGGCTGG - Exonic
1184175880 22:42788467-42788489 GAAGGGACCCTGGGGGAGGCAGG + Intergenic
1184546632 22:45174118-45174140 TGAGGGAAATTGAGGGATGTGGG + Intronic
1184660109 22:45961718-45961740 GATGGGAAACTGAGGCAGGGAGG - Intronic
1184836951 22:47029484-47029506 GGAGGGAAGAGGAGGGAGGTTGG - Intronic
1185156259 22:49195217-49195239 GGAGGGAACCTCAGGAAGGCTGG - Intergenic
949182874 3:1155813-1155835 AGAGAGAAACTGTAGGAGGCTGG - Intronic
949397890 3:3634596-3634618 TGAAGGAAACTGAAGGAGGCTGG + Intergenic
949519105 3:4833624-4833646 AGAGGGAAACAGAAGGAAGCAGG - Intronic
949670865 3:6398216-6398238 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
950140047 3:10609174-10609196 GGAGGGTAAGTGAGGGACGTGGG - Intronic
950199508 3:11033334-11033356 GGAGGGACATTGAGAGTGGCAGG + Intronic
950448409 3:13051762-13051784 AGAGGGAAACTGAGGCAGGGAGG - Intronic
950773365 3:15330028-15330050 GCAGGGAAGCAGAAGGAGGCGGG + Intronic
950798971 3:15534008-15534030 GGAGAGAGACTGGGGGAGGCAGG - Intergenic
950926202 3:16744855-16744877 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
951299085 3:20972622-20972644 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
951850795 3:27138040-27138062 GGAGGGATGCTGAAGGAGGATGG + Intronic
951941164 3:28080137-28080159 AGTGGGAAAATGAGAGAGGCAGG + Intergenic
951959444 3:28300622-28300644 GGAGGGAAAGGGATGGAGGGAGG - Intronic
951959451 3:28300640-28300662 GGAGGGAAAGGGATGGAGGGAGG - Intronic
952503947 3:33990366-33990388 GGAGGGAATCTGTGGAAAGCAGG - Intergenic
952663733 3:35879469-35879491 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
952706218 3:36380480-36380502 GGAGGGAGAGGGAGCGAGGCTGG + Exonic
952742303 3:36746477-36746499 GTAGGAAAACTGAGGGATGAGGG - Intergenic
952760088 3:36905823-36905845 GAAAGGGGACTGAGGGAGGCAGG - Intronic
952885434 3:38008774-38008796 GGTGGGTCACTGAGGGTGGCAGG - Intronic
952887382 3:38020012-38020034 GTGGGGAAACTGAGGCTGGCTGG - Intronic
952895555 3:38076174-38076196 TGAGGGATAGTGAGGGAGGTTGG + Intronic
952896825 3:38083061-38083083 TGAGGGATAGTGAGGGAGGTTGG + Intronic
953026003 3:39145340-39145362 GGAGGGAAAAGGTGGGAGGCGGG - Intronic
953176891 3:40561472-40561494 TGAGGGATAGTGAGGGAGGTTGG - Intronic
953330624 3:42050168-42050190 GGAAGGGAACTGAGGGTGGGGGG + Intronic
953825990 3:46251410-46251432 TGAGGGATAGTGAGGGAGGTTGG + Intronic
953889679 3:46742807-46742829 TGATGGTAACGGAGGGAGGCCGG + Intronic
953930780 3:47004755-47004777 GGAGGGGAAGGGAGTGAGGCTGG - Intronic
954130471 3:48558225-48558247 GGCGGGAAACTGCAGGAGTCCGG - Intronic
954584260 3:51720261-51720283 GAAGGGGAAATGAGGGGGGCAGG - Intergenic
954792518 3:53143782-53143804 AGAGGAAAATGGAGGGAGGCAGG - Intergenic
954876392 3:53805694-53805716 GGAGGGAAGATGAGGGAGGGAGG - Intronic
954876466 3:53805960-53805982 GGAGGGAAGATGAGGGAGGGAGG - Intronic
954876528 3:53806194-53806216 GGAGGGAAGATGAGGGAGGAGGG - Intronic
954969537 3:54639555-54639577 TGAGGGATAGTGAGGGAGGTTGG + Intronic
955054211 3:55441713-55441735 TGAGGATAACAGAGGGAGGCTGG + Intergenic
955406226 3:58627291-58627313 GAAGGGAAACTGAGGCAGCTGGG + Exonic
955851080 3:63220614-63220636 GGAGTGAAGAAGAGGGAGGCTGG - Intergenic
956405471 3:68924424-68924446 GGAGTGAAACTCAGAGAGACAGG + Intronic
956708965 3:72023708-72023730 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
956825906 3:72996889-72996911 GGGGGGAAACGAAGGGAGCCGGG - Exonic
956892076 3:73623252-73623274 TGAGGGAAACTGAGGGATCTGGG + Intronic
957025186 3:75173632-75173654 GGAGGCAAGCTGAAGGAGGAAGG + Intergenic
957322709 3:78653209-78653231 GCAGGGAACTGGAGGGAGGCAGG - Intronic
957466686 3:80602527-80602549 GGAGGGAGAAGGAGGAAGGCAGG + Intergenic
957507414 3:81140820-81140842 GGAGGGAGAATGAGGAAGGAAGG + Intergenic
958082356 3:88762566-88762588 GGAGGGCAAGGGAGGGAGGAGGG + Intergenic
958170532 3:89933821-89933843 GGAAGGAAACTGATAGTGGCAGG - Intergenic
959341580 3:105138229-105138251 GGAGGGAAACTTAGGAAGTTTGG + Intergenic
959434538 3:106298190-106298212 GGAGAGAAAGAGAGGGAGGAGGG - Intergenic
959486033 3:106927785-106927807 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
959881461 3:111448594-111448616 GGAGGGAAAGTGTGGGTGGGGGG - Intronic
960046856 3:113206976-113206998 GGAGAGAAACTGGGAGAGGAAGG + Intergenic
960283142 3:115798519-115798541 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
960310444 3:116110603-116110625 TGAGGGATAGTGAGGGAGGTTGG + Intronic
960396288 3:117141751-117141773 GGAGGGAAGAGGAGGGAGGGAGG - Intergenic
960572748 3:119201664-119201686 GGTGATAAACTGAGTGAGGCAGG + Intronic
961083203 3:124043908-124043930 GGAGGGAAACTCAGGCAAGATGG + Intergenic
961165025 3:124757559-124757581 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
961293223 3:125864269-125864291 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
961334265 3:126160813-126160835 GCAGGGAAGCTGATGGAGGGCGG - Intronic
961620127 3:128217472-128217494 GCTGGGAGATTGAGGGAGGCAGG - Intronic
961730310 3:128960427-128960449 TGAGGGATAGTGAGGGAGGTTGG - Intronic
961749680 3:129087913-129087935 GGGGGGAAGCAGAGGGAGGTGGG - Exonic
961871060 3:129988561-129988583 GGAGTGAAACTGCAGCAGGCAGG - Intergenic
962201510 3:133404289-133404311 GTAGGGAGACAGAGGGAGGTAGG - Intronic
962244397 3:133779712-133779734 GCAGGGATACTGCTGGAGGCTGG - Intergenic
962816022 3:139001180-139001202 GGAGGGAAAGAATGGGAGGCAGG - Intergenic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
963424953 3:145113646-145113668 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
963456956 3:145556315-145556337 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
963468349 3:145711022-145711044 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
963751069 3:149180494-149180516 GGATGGAAAATGAGTGTGGCTGG - Intronic
964559906 3:157982824-157982846 TGATGGAAACTGAGGAAGACTGG + Intergenic
964807956 3:160632019-160632041 GGAGGGAAAATGAGGATGCCAGG - Intergenic
965262910 3:166505822-166505844 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
965626628 3:170688609-170688631 TGAGGGATAGTGAGGGAGGTTGG + Intronic
965652254 3:170946880-170946902 GGAGGGAAACAGAGAGAGAGAGG + Intergenic
965836399 3:172858000-172858022 GGAGTGAAACTGATGCAGGAGGG + Intergenic
965858706 3:173120702-173120724 GGAGGGAAATGGAGAGAGGGAGG - Intronic
965864886 3:173194473-173194495 GGAGGGCAACTAAGGAAGGAAGG + Intergenic
966066519 3:175828110-175828132 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
966085162 3:176061923-176061945 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
966105360 3:176326715-176326737 TGAGGGATAGTGAGGGAAGCCGG + Intergenic
966432509 3:179847028-179847050 GGAGAGAGAGAGAGGGAGGCAGG - Intronic
966444547 3:179987229-179987251 GGAGGGAAATGAAGGGAGGGAGG - Intronic
966886905 3:184381861-184381883 GGAGGGAAACTGGGAGAGCTGGG + Intronic
966938804 3:184732109-184732131 GGAAGGAAACTGAGGGTGACAGG - Intergenic
967151845 3:186658346-186658368 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
967495953 3:190145163-190145185 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
967509094 3:190289050-190289072 GGAGGTCAACTGAAGAAGGCTGG + Intergenic
967561123 3:190920786-190920808 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
967624962 3:191671730-191671752 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
967644111 3:191900504-191900526 TGAGGGATACTGAGGGAGGTTGG + Intergenic
967740203 3:192996232-192996254 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
968039346 3:195575521-195575543 GGAGGGAAACTGAGGTACAGAGG + Intronic
968283408 3:197493979-197494001 GGAGGGAAAGGGAGGAAGGAAGG - Intergenic
968361698 3:198151841-198151863 GGAAGGAAACTGTGGCTGGCTGG - Intergenic
968739632 4:2320882-2320904 GGAGGGACAGTGAGGAAAGCCGG - Intronic
969004056 4:4005214-4005236 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
969463916 4:7343651-7343673 ATGGGGAAACTGAGGCAGGCAGG - Intronic
969525318 4:7701255-7701277 GGAGGGAAGAAGAGGGAGGGAGG + Intronic
969809852 4:9639503-9639525 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
970029469 4:11658670-11658692 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
970041835 4:11806919-11806941 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
970087308 4:12364442-12364464 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
970535539 4:17026591-17026613 GGAGGGTAATGGAGGGAGGCTGG + Intergenic
970620361 4:17811233-17811255 GGAGGGCCCCTGAGGGAGGGTGG - Intronic
970723635 4:19016936-19016958 TGAGGGATAGTGAGAGAGGCTGG - Intergenic
970889559 4:21027433-21027455 TGAGGGAAAAAAAGGGAGGCAGG + Intronic
970932669 4:21531324-21531346 GGAGGGGAAGGGAGGGAGGGAGG - Intronic
971018496 4:22512006-22512028 CTAGGGAGACTGAGGCAGGCAGG - Intronic
971143315 4:23948338-23948360 GGAGGGAGCAGGAGGGAGGCAGG + Intergenic
971180292 4:24323891-24323913 TGAGGGATAGTGAGGGAAGCTGG - Intergenic
971199844 4:24501601-24501623 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
971251430 4:24976022-24976044 GGAGGGAAGGAGAGGGAGGGGGG + Intronic
972114834 4:35618912-35618934 GGAAGGAAACTGATGGAGTAAGG - Intergenic
972142073 4:35973273-35973295 GGAGGGGAAGGGAGGGAGGAAGG + Intronic
972142088 4:35973322-35973344 AGGGGGAAAGGGAGGGAGGCAGG + Intronic
972425170 4:38926337-38926359 GGAGGGACAGTGAGAGGGGCTGG - Intronic
972698613 4:41472337-41472359 GGAGGGGCAGGGAGGGAGGCAGG - Intronic
972698623 4:41472359-41472381 GGAAGGAAAGAGAGGGAGGAAGG - Intronic
972981119 4:44703071-44703093 AGATGGAAACTGAAGGAGACTGG - Exonic
974011458 4:56611421-56611443 GGGGGGAAAGTGTGGGAAGCGGG + Intergenic
974022989 4:56708034-56708056 GAAGGGAAAGTAAGGGAGGGAGG + Intergenic
974038323 4:56836589-56836611 AGATGGAAACTGAGGGAGAGGGG + Intergenic
974369196 4:60992240-60992262 GGAAGAAAGCTGTGGGAGGCTGG + Intergenic
974409861 4:61526008-61526030 GGAGGGACAAGGAGGGATGCTGG + Intronic
974428663 4:61769345-61769367 TGAGGGATAGTGAGGGAGGTTGG + Intronic
974655105 4:64808710-64808732 GTAGGGAGACTGGAGGAGGCAGG - Intergenic
974910034 4:68106586-68106608 GGTGGGAAACTGCGGGGGGAGGG + Intronic
975553583 4:75637994-75638016 GGAGGGTAACTGGGAGAGGCTGG - Intergenic
975799425 4:78044198-78044220 TTTGGGAAACTGAGGCAGGCAGG - Intergenic
975967577 4:79993240-79993262 GGAGAGAAAAGGAGGGAGGAAGG + Intronic
976104159 4:81599102-81599124 AAAGGGAAACTGAAGGAGCCAGG - Intronic
976350064 4:84051094-84051116 AGAGGGAACCTGAGGGGGTCGGG - Intergenic
976400408 4:84600870-84600892 GAATGGAAATGGAGGGAGGCTGG + Intronic
976675225 4:87695386-87695408 GGAGGGAAGGGGAGGGAGGGAGG + Intergenic
976695821 4:87918779-87918801 GGAGGGAAAGGGAGGGAGGGAGG + Intergenic
976738324 4:88333186-88333208 GGAGGGAAAGGGTGGGAGGCGGG + Intergenic
976906311 4:90240511-90240533 GGAGGGACACTGCAGGAGGAAGG - Intronic
977198683 4:94089589-94089611 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
977231778 4:94459926-94459948 GGAGGGAAACTGCAGCTGGCAGG - Intronic
977672648 4:99714205-99714227 GAAGAGAACCTGAAGGAGGCAGG + Intergenic
977807944 4:101324645-101324667 AGAGTTACACTGAGGGAGGCAGG - Intronic
978001394 4:103558845-103558867 TGAGGGACAGTGAGGGAAGCTGG + Intergenic
978435006 4:108674673-108674695 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
978455884 4:108890840-108890862 GGAGAGAAATTGAGGGAGCTGGG - Intronic
978490171 4:109303271-109303293 TGTGGGAAAGTGAGGGAGGAGGG - Intergenic
978900818 4:113947549-113947571 AGAGGGAGAGTGAGGGAGGGAGG + Intronic
979146342 4:117252682-117252704 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
979379601 4:119994291-119994313 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
980119006 4:128708625-128708647 GGAAGGAAACGGAGGGAGGCTGG + Intergenic
980527609 4:134012796-134012818 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
980612066 4:135172491-135172513 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
981360776 4:143843310-143843332 GGAGGAAAACTGAGGGGGAAAGG + Intergenic
981380617 4:144067574-144067596 GGAGGAAAACTGAGGGGGAAAGG + Intergenic
981539413 4:145833185-145833207 TGAGGGATAGTGAGGGAGGTTGG - Intronic
982084224 4:151817633-151817655 TGAGGGATAATGAGGGAGGTTGG + Intergenic
982127931 4:152200317-152200339 GGAAGGAAAGTGAGGCTGGCTGG - Intergenic
982174051 4:152688757-152688779 GGAGGGAAAATAAAGGAGGCAGG + Intronic
982180776 4:152746511-152746533 TGAGGGATAGTGAGGGAGGTTGG + Intronic
982414478 4:155113589-155113611 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
983308210 4:166021368-166021390 GGAGGGAAGCAGAGGGAGGAAGG - Intronic
983447790 4:167876884-167876906 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
983659304 4:170117013-170117035 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
983707436 4:170678220-170678242 TGAGGGATAATGAGGGAGGTTGG - Intergenic
983884110 4:172961702-172961724 TGAGGGATAGTGAGAGAGGCTGG + Intronic
984238415 4:177189397-177189419 GGAGGGAGGAGGAGGGAGGCAGG - Intergenic
984607676 4:181804117-181804139 GGAGGGAAAGGGAGGGAGGGAGG + Intergenic
984700335 4:182814917-182814939 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
984707865 4:182861082-182861104 TGAGGGAAAAGGAGGGAGACGGG - Intergenic
984978918 4:185258369-185258391 GGAGGGCAACTGGAGGAGGAAGG - Intronic
985057613 4:186049077-186049099 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
985070809 4:186165060-186165082 AGAGGGAAAGTGAGGCTGGCAGG - Intronic
985435460 4:189926468-189926490 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
985801631 5:2008302-2008324 GGAAGGAAACCGCGGGAGCCAGG - Intergenic
985816557 5:2132180-2132202 GGGAGGAAACTGAGGCAGGGAGG + Intergenic
986193255 5:5516148-5516170 TGAGGGATAGTGAGGGAAGCTGG - Intergenic
986463034 5:7992878-7992900 GGAGGGTAAGTGAGGGAGGAAGG + Intergenic
986555851 5:9009075-9009097 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
986636078 5:9823641-9823663 GGAGGGAAAGGGAGGAAGGGAGG + Intergenic
986905508 5:12490490-12490512 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
987246048 5:16049918-16049940 GGATGGGAACTGAGGAATGCAGG + Intergenic
987281749 5:16420554-16420576 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
987614524 5:20255132-20255154 GGAGGGAAGGAGAGGGAGGATGG + Intronic
987619962 5:20328098-20328120 GGAGGCATAATGAGGGAGGAAGG + Intronic
987620611 5:20335145-20335167 GGAGGCATAATGAGGGAGGAAGG - Intronic
987764040 5:22202112-22202134 GGAGGAAAAGAGAGGGAGGGAGG - Intronic
988348437 5:30069976-30069998 GGTGGGGCACTCAGGGAGGCGGG - Intergenic
988366997 5:30313105-30313127 GGAGTGTAACTGAGGGATGAAGG + Intergenic
988615327 5:32769574-32769596 GGAGGGAAACTAAGGGTGCCAGG - Intronic
988895257 5:35665428-35665450 GGAGAGGAACAGAGGGAGGGAGG + Intronic
989644814 5:43619941-43619963 AGAGAGAAACTGAGGGAGCCAGG + Intronic
990115326 5:52382674-52382696 AGTGGGAAACTGAGGGGGTCTGG - Intergenic
990215356 5:53525804-53525826 GAAGGGACAGTGAGGGAGGGAGG - Intergenic
990353455 5:54941468-54941490 GAAGGGAAACAGAGGGTAGCAGG - Intergenic
991044846 5:62211714-62211736 GGAGGGATACTGTGGGAGGAAGG - Intergenic
991433572 5:66573305-66573327 GGAGGGAAAGGGAGGGAGGGAGG + Intergenic
991507339 5:67339148-67339170 GGAGGAAGACAGAGGGAGGGAGG - Intergenic
991518464 5:67466508-67466530 TTAGGGAGACTGAGGCAGGCAGG - Intergenic
991898765 5:71435190-71435212 GGAGGAAAAGAGAGGGAGGGAGG - Intergenic
992394370 5:76357881-76357903 TGAGGGACAGTGAGAGAGGCTGG - Intergenic
992480094 5:77142657-77142679 GGAGGGAATCTGTGGAAAGCAGG + Intergenic
992549946 5:77850768-77850790 TGAGGGAAAATGACGGATGCGGG - Intronic
992624810 5:78627349-78627371 ACAGGGAAAGTGAGGGAGGCTGG - Intronic
992658662 5:78936060-78936082 GAAGGGAAAGAGAGGGAGGGAGG - Intronic
992658671 5:78936086-78936108 GGAGGGAAAGAGAGAGAGGCGGG - Intronic
993192382 5:84698844-84698866 TGAGGGACAGTGAGAGAGGCTGG - Intergenic
993445139 5:88002519-88002541 TGAGGGAAACAGTGAGAGGCAGG - Intergenic
993900734 5:93582889-93582911 GGAGAGAAAGTGAGGGAGGGGGG - Intergenic
994065040 5:95529775-95529797 GGAGGGAGAGGGAGGGAGGGAGG - Intronic
994197538 5:96936312-96936334 AGAGGGGATCTGGGGGAGGCAGG + Intronic
994681930 5:102899035-102899057 GGAGGGAAAGGAAGGGAGGAAGG - Intronic
994731047 5:103490675-103490697 GGAGGGAGAATGAAGGAGGAGGG - Intergenic
994738685 5:103591200-103591222 TAAGGGAAACTGTGGGAGGTTGG - Intergenic
995023998 5:107398125-107398147 GGAGGGATAAAGAGGGAGCCTGG - Intronic
995106448 5:108381727-108381749 GGAGGGAGACCCAGAGAGGCGGG + Exonic
995416786 5:111921781-111921803 GGAGGGACCCGGAGGGAGGTAGG + Intronic
995716540 5:115086499-115086521 GGAGGGAGAGAGAGGGAGGGAGG + Intergenic
995814986 5:116158121-116158143 GGAGGGGAAGGGAGGGAGGGAGG - Intronic
995836839 5:116407770-116407792 ATTGGGAAACTGAGGCAGGCGGG - Intronic
996094791 5:119386970-119386992 GGAAGGAAAGAGAGGGAGGGAGG - Intronic
996203552 5:120702763-120702785 GGAGGGACAGTGAGAGAGGTTGG + Intergenic
996949036 5:129102791-129102813 GAAAGGAAACTGCTGGAGGCAGG - Intronic
997021493 5:130007855-130007877 ACAGGGACACTGAGAGAGGCTGG - Intronic
997208632 5:132064995-132065017 GGAGGGAAAGTGAGGGCTGGGGG - Intergenic
997746142 5:136302007-136302029 TGAGGGATAGTGAGGGAGGTTGG - Intronic
997769963 5:136544770-136544792 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
997890511 5:137672281-137672303 GGAGGCAGGCTGTGGGAGGCAGG - Intronic
998157453 5:139795121-139795143 AGAAAGAACCTGAGGGAGGCGGG - Intergenic
998204751 5:140150413-140150435 TGTGGGAAACTCAGGCAGGCAGG - Intergenic
998283678 5:140836704-140836726 GGATGGACCCTGAGGAAGGCTGG - Exonic
998693929 5:144616293-144616315 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
998984743 5:147743956-147743978 GGAGGGAGAAGGAGGGAGGGAGG - Intronic
998996646 5:147873880-147873902 TGAGGGATAGTGAGGGAGGTTGG + Intronic
999030381 5:148284105-148284127 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
999278304 5:150347037-150347059 GGAGGGAAAAGGAGGGAGACTGG + Intergenic
999496961 5:152108494-152108516 GTAGGGAAGCAGAGGGAGGGTGG + Intergenic
999855985 5:155594676-155594698 GGAGGGAAACTGATGAAACCTGG + Intergenic
999887213 5:155936836-155936858 GGAGGGAGACTGAGTGAGTGGGG - Intronic
1000519705 5:162280553-162280575 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1001035428 5:168292888-168292910 GGAGGGCAGATGAGGGAGACTGG + Intronic
1001089404 5:168726385-168726407 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089410 5:168726403-168726425 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089433 5:168726461-168726483 GGAGGGAGAGGGAGGGAGGAAGG + Intronic
1001089442 5:168726483-168726505 GGAGGGAGGGAGAGGGAGGCAGG + Intronic
1001160435 5:169307907-169307929 TGAGAGAAACAGAGGGAGGGTGG + Intergenic
1001225910 5:169944447-169944469 GGAGAGATGCTGAAGGAGGCAGG + Intronic
1001250433 5:170142931-170142953 GGGAGGGGACTGAGGGAGGCAGG - Intergenic
1001428900 5:171644399-171644421 GGAGGGAAAGGGAGTGAGTCCGG + Intergenic
1001591134 5:172866253-172866275 GGAGAGAAGCGGAGGGAGGTGGG + Intronic
1001781939 5:174376278-174376300 GGAGGAAAACTGGGTGAGACTGG - Intergenic
1002017436 5:176336067-176336089 GAAGGGAGAGGGAGGGAGGCAGG + Intronic
1002085737 5:176774406-176774428 GGAGGGAACATGGGGGAGGCTGG - Intergenic
1002166079 5:177347259-177347281 GAAGGGCAACTGAGTGAGGGAGG + Intronic
1002177355 5:177408775-177408797 CTGGGGAAACTGAGGAAGGCTGG + Intronic
1002434092 5:179220762-179220784 CAAGGGAAACTGAGGTTGGCAGG - Intronic
1002803755 6:551973-551995 GGAGAGAAAGCGAGGGAAGCTGG - Intronic
1002859157 6:1064768-1064790 GGAGGGCAGGTGAGGGAGGTTGG + Intergenic
1002895349 6:1376901-1376923 GGATGGAGGCTGAGGGAGGCAGG - Intergenic
1003549187 6:7086619-7086641 AGATGGAAGCTGAGGAAGGCTGG - Intergenic
1003765730 6:9234371-9234393 GCAGGGAAAATGAGAGAGGGAGG - Intergenic
1003941293 6:11029926-11029948 ATAGGGAAACTGAGGCAAGCTGG - Intronic
1004105920 6:12667756-12667778 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1004360695 6:14968148-14968170 GGAGTGGGAGTGAGGGAGGCAGG + Intergenic
1004508311 6:16264291-16264313 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1004836753 6:19539611-19539633 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1005205537 6:23399282-23399304 GGAGGGAAAGGGTGGGAGGAGGG - Intergenic
1005840737 6:29743274-29743296 GCACAGAAACTCAGGGAGGCAGG + Intergenic
1006034641 6:31202032-31202054 GGAGAGAAACTGAGACACGCAGG + Intronic
1006149598 6:31979597-31979619 GGATGGAACTGGAGGGAGGCAGG - Intronic
1006374174 6:33662766-33662788 GGAGGGACTCAGAGGGAGGTAGG - Intronic
1006401610 6:33821057-33821079 GCAGGGGAACTGAGGGAGGTGGG + Intergenic
1006472086 6:34235267-34235289 GGAGGGGAGCAGAGGGCGGCGGG - Intergenic
1006522840 6:34581897-34581919 GGAGGAAAAGTGAAGAAGGCTGG + Intergenic
1006780214 6:36627495-36627517 GGAGGAAAACTGGAAGAGGCTGG - Intergenic
1007048801 6:38804676-38804698 GTAGGGAATCTGTGGGAAGCTGG + Intronic
1007125514 6:39422742-39422764 GGAGGGAGACTGGGGCTGGCTGG - Intronic
1007253879 6:40515214-40515236 AGAGGGATGCTGAGGGAGGCTGG + Intronic
1007552505 6:42740990-42741012 GGAGGGGAAATGAAGGAGGGAGG - Intergenic
1007957765 6:45932889-45932911 GGAAGGGAAATGAGAGAGGCAGG + Intronic
1008036040 6:46746103-46746125 GGATGGAGAATGAGGGAGGTGGG + Intergenic
1008057452 6:46959827-46959849 GGAGGGAAGATGAGGGAGGGAGG + Intergenic
1008057458 6:46959845-46959867 GGAGGGAAGATGAGGGAGGGAGG + Intergenic
1009343337 6:62586556-62586578 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1009442639 6:63699883-63699905 GAAAGAAACCTGAGGGAGGCCGG - Intronic
1009828433 6:68897754-68897776 GGAGGAAAAGGGAGGGAGGAAGG + Intronic
1010672511 6:78702985-78703007 GGGGGGAAACTCAGGGAGATAGG - Intergenic
1010829903 6:80515195-80515217 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1010841558 6:80652785-80652807 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1011071862 6:83393477-83393499 GGTGGGAGACTGAGTGTGGCAGG - Intronic
1011123119 6:83976973-83976995 GGAGGTAAACGGAGTGAGTCGGG - Intergenic
1011657736 6:89566705-89566727 GGAGGGTAGCTGTGGGAGGCAGG - Intronic
1012142056 6:95636614-95636636 GGAGGGAGGCTGAGGTAGGAAGG - Intergenic
1012249516 6:96964173-96964195 GGAGGGGAACTGCAGGAGACTGG + Intronic
1012300394 6:97580531-97580553 GTAGTGTAAATGAGGGAGGCGGG - Intergenic
1012689255 6:102293334-102293356 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1013015802 6:106159651-106159673 GGAGGGAGACTAAGGAAGGCAGG + Intergenic
1013227749 6:108132825-108132847 GCGGGGAAAATGAGGGAGGGTGG - Intronic
1013233431 6:108176345-108176367 AGAGGGAATCTGAGGGAGGAAGG - Intronic
1013594034 6:111645199-111645221 GGAGGGACACAGAAGGGGGCTGG - Intergenic
1013608499 6:111773286-111773308 GGAGAGAAAGAGAGGGAGGGAGG + Intronic
1013668825 6:112376155-112376177 AGAAGGAAAATGAGGGAGGGAGG + Intergenic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1013897224 6:115103377-115103399 GGAGAGAAACTGAGGCAACCAGG - Intergenic
1014307410 6:119759077-119759099 GGAGGGAGAGGGAGGGAGGGAGG - Intergenic
1014718327 6:124891014-124891036 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1014889202 6:126821749-126821771 AGAGAGAGACTGATGGAGGCAGG - Intergenic
1015127965 6:129775293-129775315 AGAGGGACACTGCGGGAGGATGG - Intergenic
1015152547 6:130055635-130055657 GGAGGGAGAGAGAGGGAGGGAGG - Intronic
1015152553 6:130055653-130055675 GGAGGGAGAGAGAGGGAGGGAGG - Intronic
1015164926 6:130192886-130192908 TGAGGGATAGTGAGGGAGGTTGG - Intronic
1015186801 6:130426462-130426484 GAAGGGAAACTGAGGGGGGGGGG - Intronic
1015269367 6:131323922-131323944 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1015271071 6:131339426-131339448 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1015485083 6:133760724-133760746 GGAGGGATGCTGAGAGAGTCAGG - Intergenic
1015489840 6:133812569-133812591 GGAGGGAAGGGGAGGGAGGGAGG + Intergenic
1015489958 6:133813682-133813704 AGACTGAAAGTGAGGGAGGCTGG + Intergenic
1016114413 6:140262472-140262494 TGAGGGATAGTGAGGGAGGCTGG + Intergenic
1016518522 6:144923782-144923804 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1016861322 6:148721478-148721500 GGAGAGTAACAGAGGGAAGCCGG - Intergenic
1017249176 6:152261319-152261341 AGAGGGCAAATGAGGGAGTCAGG - Intronic
1017380265 6:153820458-153820480 GGAGGAAAAGTGGGGGAGGGAGG - Intergenic
1017503025 6:155042924-155042946 GTAAAGTAACTGAGGGAGGCTGG - Intronic
1017532522 6:155310430-155310452 AGATGGAAATTGAGGGAGGCAGG - Intronic
1017779635 6:157705889-157705911 GGAGGGATAGTGAGGGAGGTTGG + Intronic
1018084795 6:160291715-160291737 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1018360340 6:163061442-163061464 GGAGGGACACTGAGGGTGATGGG + Intronic
1018425926 6:163680515-163680537 GGAAGGAAAGGGAGGGAGGGAGG - Intergenic
1018495753 6:164344174-164344196 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1018521804 6:164657456-164657478 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1018573444 6:165233941-165233963 GGAGGGAAGCAGAGGCAGGAAGG - Intergenic
1018575133 6:165251937-165251959 GGTGGGAAACTGAGAGAGTATGG + Intergenic
1018861223 6:167712256-167712278 GGAGGGGGAATGAGGGTGGCTGG + Intergenic
1018885411 6:167931283-167931305 GCAGGGAAACTGAAGGGGGCAGG + Intronic
1018978412 6:168582935-168582957 AGGGGGAGATTGAGGGAGGCGGG - Intronic
1019077851 6:169404633-169404655 GGAGAGAAAGTGAGGAAGGCAGG + Intergenic
1019253986 7:36881-36903 GGAAGGAAACTGTGGCTGGCTGG + Intergenic
1019258397 7:66024-66046 GGAGAGAAACTGAGGCGGTCAGG - Intergenic
1019313467 7:373971-373993 GGAGGGAAAGGGAAGGAGGGAGG + Intergenic
1019315076 7:380548-380570 GCAGGGGGACAGAGGGAGGCAGG + Intergenic
1019500339 7:1361316-1361338 GGAGGGAGCCTGAGGGGGGCAGG + Intergenic
1019532775 7:1511876-1511898 GGAAGGAAACTGAGGCAGAGAGG - Intergenic
1019712337 7:2523454-2523476 GGAAGGAAACTGAGGCTGGGTGG + Intronic
1019730565 7:2627345-2627367 GGAGGGAAAGAGAGGAAGGGAGG + Intergenic
1019776113 7:2913000-2913022 GGAGGGAAGAAGAGGGAGGAGGG + Intronic
1019989267 7:4681057-4681079 GGAAGGAAATGGAGGGAGGAAGG + Intergenic
1019989327 7:4681257-4681279 GGAAGGAAAGGGAGGGAGGAAGG + Intergenic
1020011506 7:4808061-4808083 GGAGAGAGACAGAGGGAGGGAGG - Intronic
1020241155 7:6396205-6396227 GGAAGGAAACTGAGAGACCCTGG + Intronic
1020324196 7:6961715-6961737 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1020541386 7:9463567-9463589 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1020611641 7:10404512-10404534 GGAGGGGAAGAGAGGGAGGGAGG + Intergenic
1020990010 7:15184550-15184572 GGAAGGAAAAGGAGGGAGGGAGG + Intergenic
1020990043 7:15184660-15184682 GGAAGGAAAAGGAGGGAGGGAGG + Intergenic
1020990062 7:15184716-15184738 GGAAGGAAAAGGAGGGAGGGAGG + Intergenic
1021172455 7:17414657-17414679 TGAGGGATAGTGAGAGAGGCTGG - Intergenic
1021547987 7:21837565-21837587 GGAGGTAAAAGGAGGGAGGATGG + Intronic
1021963192 7:25892882-25892904 GGAGGGGAAGTGGGGGACGCAGG - Intergenic
1022173250 7:27849539-27849561 GGTGGGAACCTGGGGCAGGCAGG + Intronic
1022372614 7:29785565-29785587 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1022501890 7:30887120-30887142 TGGGGGTAGCTGAGGGAGGCGGG - Intronic
1022854990 7:34304936-34304958 TGAGGGATACTGAGGGAGGTTGG + Intergenic
1023370185 7:39505496-39505518 GGGGGGAAAGAGAGGGAGGGAGG - Intergenic
1023699174 7:42875726-42875748 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1023840363 7:44093713-44093735 GGATGGAGACTGAGAGGGGCGGG + Intergenic
1024283209 7:47736317-47736339 GGAGGGAAAGGGAGGGAGGGAGG - Intronic
1024318971 7:48046347-48046369 GGAGGGAGACAGAAGGAGGGAGG + Intronic
1024462232 7:49670571-49670593 TGAGGGAAACCGAGGGAGGCTGG - Intergenic
1024496159 7:50048016-50048038 GGAGGGTAACTGAGGGTGAAAGG + Intronic
1024523896 7:50331797-50331819 GGAGGCCAACTGAGGGCTGCAGG - Intronic
1024697311 7:51870506-51870528 TGAGGGACAGTGAGGGAGGTTGG - Intergenic
1025624764 7:63210971-63210993 AGAGATAAAGTGAGGGAGGCTGG - Intergenic
1025626900 7:63230821-63230843 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025626912 7:63230867-63230889 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025958664 7:66201961-66201983 GGAGGGAAACTGAAGGACTTGGG - Intergenic
1026040728 7:66865874-66865896 GGAGGGGAAGGGAGGGAGGGAGG - Intergenic
1026040737 7:66865892-66865914 GGAGGTAAAGGGAGGGAGGGAGG - Intergenic
1026261388 7:68758796-68758818 AGAGAGAGAGTGAGGGAGGCAGG + Intergenic
1026309799 7:69173625-69173647 AAAGGGAAATTGGGGGAGGCTGG + Intergenic
1026649999 7:72208954-72208976 GGAAGGAAAGGGAGGGAGGGAGG - Intronic
1026660139 7:72293461-72293483 GGCGGGAAAAAGAGAGAGGCTGG - Intronic
1026830423 7:73607058-73607080 GGGGGGAAAGTGATGGAGGATGG - Intronic
1026832983 7:73621684-73621706 GGAGGGAGATGGAGGGAGGGAGG - Intronic
1026832998 7:73621730-73621752 GGAGGGAGATGGAGGGAGGGAGG - Intronic
1026833040 7:73621846-73621868 GGAGGGAGAAGGAGGGAGGGAGG - Intronic
1026844536 7:73690791-73690813 GAAGGGAAGCTGTGGGAGGAGGG + Intronic
1026938065 7:74270325-74270347 GGAGGGTAAAGGAGGGAGGGAGG - Intergenic
1026977413 7:74506993-74507015 GGAGGGAAACTGAGGCTGGAAGG + Intronic
1027485559 7:78757282-78757304 GGAGGGAGAAGGAGGGAGGGAGG - Intronic
1028615521 7:92762376-92762398 GGAAGGAAGCAGAGGGAAGCAGG + Intronic
1028687064 7:93602217-93602239 GGAGGCAAACACAGGTAGGCTGG - Intronic
1028718399 7:94000892-94000914 CTTGGGAAGCTGAGGGAGGCAGG + Intronic
1028986265 7:97011089-97011111 GGAAGGGAAGTGAGGGAGGAGGG - Intergenic
1029227851 7:99041024-99041046 AGAGGGAAAGAGAGGGAGGGAGG + Intronic
1029327213 7:99820361-99820383 GGAGGGAAAGTATGGGAGGCAGG - Intergenic
1029405461 7:100372151-100372173 ACAGGGAAACTGAGGGACGGGGG - Intronic
1029602208 7:101574032-101574054 GGAGAGAGAGTGAGGGAAGCAGG + Intergenic
1029896150 7:103987559-103987581 GGTGGGTAAGTGAGTGAGGCTGG - Intronic
1030231875 7:107216076-107216098 AAATGGAAACTGAGAGAGGCAGG + Intronic
1030441931 7:109596991-109597013 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1030445995 7:109646968-109646990 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1031021901 7:116638143-116638165 AGAGGGAGACGGAGGGAGGGAGG - Intergenic
1031174852 7:118337595-118337617 TGAGGGACTCTGAGGGAGGTGGG - Intergenic
1031296406 7:120009805-120009827 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1031365026 7:120890786-120890808 TGAGGGATAGTGAGGGAGGCTGG + Intergenic
1031422725 7:121569072-121569094 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1031601581 7:123716658-123716680 GGAGAGAGAAAGAGGGAGGCAGG + Intronic
1031685600 7:124729730-124729752 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1031728205 7:125263993-125264015 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1031777049 7:125918146-125918168 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1033348143 7:140541271-140541293 GGAGGGAGTCTGGGGGAGGCTGG + Intronic
1033600938 7:142888037-142888059 GGAGGGAGACTTAGGGAGGGAGG + Intergenic
1034087793 7:148335963-148335985 GGAAGGAGAATGAGGGAGGTGGG - Intronic
1034109174 7:148519893-148519915 AGAGGGATACTATGGGAGGCAGG - Intergenic
1034309319 7:150072688-150072710 GGAAATAAACTGAGGCAGGCAGG + Intergenic
1034385774 7:150739755-150739777 GAAGGGAAAGGGAGGGAGGCAGG + Intronic
1034526682 7:151668182-151668204 AGAGAGAAACTGAGGAAGACAGG - Intronic
1034607359 7:152329626-152329648 GAAGGGAAACGAAGGGAGGAAGG + Intronic
1035069902 7:156136255-156136277 GAAGTGAAACTGAGGAAGGAAGG - Intergenic
1035188437 7:157143963-157143985 GGAGTGAATCTCAGGGAGGGAGG + Intronic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1035605355 8:926727-926749 GGAGCTAAACTGAGTGAGCCAGG + Intergenic
1035738211 8:1904701-1904723 GCAGGGACATTCAGGGAGGCGGG + Intronic
1035768317 8:2126687-2126709 TGAGGGAGGCTGATGGAGGCTGG + Intronic
1035880900 8:3243126-3243148 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1036143031 8:6225700-6225722 GGAAGGAGAGGGAGGGAGGCCGG - Intergenic
1036371868 8:8169250-8169272 GGAGGGATAGTGAGGGAGGTTGG - Intergenic
1036639177 8:10571686-10571708 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1036879034 8:12496394-12496416 GGAGGGATAGTGAGGGAGGTTGG + Intergenic
1037169434 8:15873953-15873975 GGAAGGAGAAGGAGGGAGGCAGG - Intergenic
1037169481 8:15874105-15874127 GGAAGGAGAAGGAGGGAGGCTGG - Intergenic
1037274831 8:17166704-17166726 GGAGGAAAACTGAGAGAGTGTGG + Intronic
1037318624 8:17623042-17623064 GGAATGAAACTGATAGAGGCAGG - Intronic
1037656173 8:20886042-20886064 GGAGGGAAGGAGAGGGAGGAGGG + Intergenic
1037684807 8:21129705-21129727 TGAGGGAAACAGAGGCAGGCAGG + Intergenic
1037691734 8:21186508-21186530 GGAGGGAAACAGAGGCACGGAGG - Intergenic
1037891904 8:22628066-22628088 AGAGGGAAGGTGAGCGAGGCCGG + Intronic
1037906224 8:22717497-22717519 GGTAGGAAGCTGAGGGAGGGAGG + Intronic
1037937053 8:22921946-22921968 GGAGGTAAACTGAGGGTGGAGGG + Intronic
1037992246 8:23329260-23329282 GGAGTCAAATTGAGGGAGGCTGG - Intronic
1038405286 8:27317742-27317764 GCAGGGAATGTGAGGGAAGCTGG - Intronic
1039578324 8:38643530-38643552 GGAAGGAAAGAGAGGGAGGGAGG + Intergenic
1039718324 8:40134844-40134866 GGAAGGAAGGTGAGGGAGCCAGG + Intergenic
1039921444 8:41896757-41896779 GGAGGGAGGCGGAGGGAGGGAGG - Exonic
1040107479 8:43548865-43548887 AGAGGGACACTGAGGCAGACCGG - Intergenic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1040864329 8:52032917-52032939 GCAAGGCAACTGAGGGAGGAAGG - Intergenic
1041097259 8:54362051-54362073 GGAGTGAGCCTGAGGGAGGTTGG + Intergenic
1041330050 8:56714453-56714475 GGAAGGACAGTGAGGGAGGAAGG - Intergenic
1041652063 8:60311375-60311397 TGAGGGATAGTGAGAGAGGCTGG + Intergenic
1041727185 8:61029369-61029391 GGAGAAGAACAGAGGGAGGCGGG + Intergenic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1042663979 8:71186023-71186045 GGAGGGAAAGGGAGAGAGGGTGG - Intergenic
1043353919 8:79391055-79391077 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1043356881 8:79424044-79424066 GGAAGGAAAGGGAGGGAGGAAGG + Intergenic
1043837422 8:85063414-85063436 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1044119962 8:88382503-88382525 GGAGGGAAATGGAGGGAAGAGGG - Intergenic
1044148769 8:88747226-88747248 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1044258875 8:90095239-90095261 TGAGGGATAGTGAGGGAAGCTGG + Intronic
1044416793 8:91948595-91948617 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1044654590 8:94534557-94534579 GGAGGGAAAGTGAGGGATTGGGG - Intronic
1044921678 8:97175627-97175649 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1045218847 8:100176898-100176920 GGAGGGAAAAGGAGAGAGGGAGG - Intronic
1045291400 8:100835634-100835656 GGAGGGATGCTGAAGGAGGAAGG - Intergenic
1045457436 8:102395113-102395135 GGAGGTAGGCTGAGAGAGGCTGG - Intronic
1045950712 8:107848915-107848937 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
1046293844 8:112196451-112196473 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1046439780 8:114242230-114242252 TGAGGGACAGTGAGAGAGGCTGG - Intergenic
1046490423 8:114945316-114945338 TGGGGGAAAGTGTGGGAGGCGGG - Intergenic
1046739640 8:117814495-117814517 GGAGGGAAACTGAGATACACAGG + Intronic
1047182677 8:122604427-122604449 GGAGGGAAGCCTAGGGAGGGAGG - Intergenic
1047195958 8:122721635-122721657 GGAGAGAAAGTGAGAAAGGCAGG + Intergenic
1047251043 8:123182395-123182417 GGAGGGGAGCAGAGGCAGGCAGG + Exonic
1047428440 8:124767816-124767838 TCAGGTAAACTGAGGAAGGCTGG + Intergenic
1047448631 8:124942538-124942560 GTAGGGAAACTGAGGCATGCAGG + Intergenic
1047491322 8:125377076-125377098 TTTGGGAAACTGAGGGAGGGTGG - Intergenic
1047699064 8:127432323-127432345 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1048135200 8:131741327-131741349 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1048168724 8:132085355-132085377 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1048170839 8:132104708-132104730 GCAGGGATGGTGAGGGAGGCAGG + Intronic
1048585731 8:135772384-135772406 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1048764520 8:137829969-137829991 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1048807655 8:138255503-138255525 GGAGAGAAGCTGAGGGTGGCTGG + Intronic
1048873332 8:138816473-138816495 GGTGGGATACGGAGGGAAGCTGG - Intronic
1048889339 8:138933916-138933938 GGATGGAGACGGAGGGAGCCCGG - Intergenic
1049069113 8:140343582-140343604 GGAGGGGAAAGAAGGGAGGCTGG + Intronic
1049094446 8:140540244-140540266 GGAAGGCAAATGGGGGAGGCTGG + Intronic
1049108417 8:140627958-140627980 GGAGTGGAATTGAGGGAGGGAGG - Intronic
1049152167 8:141041962-141041984 GGAGGGAAAGTGAGAGAGAGAGG + Intergenic
1049206869 8:141367585-141367607 GGTGGGAAACTGAGGCACGGAGG + Intergenic
1049210764 8:141385445-141385467 GAAGGGAAAAAGAGGGAGGGAGG - Intergenic
1049231749 8:141488343-141488365 GGAGGGAATGTCAGGGAGGAAGG - Intergenic
1049442442 8:142615468-142615490 GGAGGGAGAGGGAGGGGGGCCGG + Intergenic
1049459835 8:142721234-142721256 GGAGGGAAACTGAGGCTCCCAGG - Intergenic
1049584766 8:143427804-143427826 GGAGAGTCACTGAGGCAGGCTGG - Intronic
1050330682 9:4542181-4542203 GGAGAGACACGGAGGGAGGGAGG + Intronic
1050685865 9:8168779-8168801 GGAAGAAAACGGAGGGAGACAGG + Intergenic
1050770092 9:9187585-9187607 AGAGGGAAAGAGAGGGAAGCAGG - Intronic
1051052362 9:12949001-12949023 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1051335387 9:16061272-16061294 GATGGAAAACTGAGGCAGGCAGG - Intronic
1051953638 9:22663462-22663484 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1052091553 9:24334885-24334907 GGGGGGAAGCTGAGGCAGACAGG - Intergenic
1053296105 9:36913850-36913872 GGAGGGAAAAGGAGAGAGGTGGG + Intronic
1053297426 9:36924832-36924854 GGAGAGAAAGGGAGGGAGGGAGG + Intronic
1053946374 9:43312960-43312982 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1054456558 9:65434321-65434343 TCAGGGAAACTGAGTCAGGCAGG - Intergenic
1054804930 9:69388588-69388610 GGAGGGAGACAGAGGAAGCCGGG + Intronic
1054807726 9:69409710-69409732 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1055590816 9:77811954-77811976 TAAGTGAAACTGAGGGAGGGAGG - Intronic
1055767630 9:79681754-79681776 GGAGAGAAAGAGAGGGAGGGAGG + Intronic
1055809757 9:80137917-80137939 TGAGGGAAAGTGAGAGAGGCTGG - Intergenic
1055881491 9:81009656-81009678 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1056045783 9:82714145-82714167 GGAGGGACACTGAAGAAGGATGG - Intergenic
1056060882 9:82884359-82884381 TGAGGGATAGTGAGGGAGGCTGG - Intergenic
1056154999 9:83825253-83825275 GTAGGGAATCTAGGGGAGGCAGG + Intronic
1056323536 9:85458949-85458971 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1056360665 9:85854650-85854672 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
1056417173 9:86388049-86388071 GGAGGGAAAGACAGGGTGGCTGG - Intergenic
1056522114 9:87411322-87411344 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1056534456 9:87515911-87515933 GCAGGGAAATGGGGGGAGGCTGG - Intronic
1056754673 9:89374234-89374256 GTAGGGGAGCTGAGGGAGGAGGG - Intronic
1056827033 9:89883617-89883639 GGAGGGAGGCTGCAGGAGGCAGG - Intergenic
1056882735 9:90413320-90413342 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1057234563 9:93348214-93348236 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1057377710 9:94540473-94540495 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1057683662 9:97215141-97215163 TGAGGGATAGTGAGGGAGGTCGG - Intergenic
1057752012 9:97800380-97800402 GGAGGGAAAGAAAGGCAGGCCGG + Intergenic
1057784365 9:98075380-98075402 GGAAGGAAACGGTGGGAGGGAGG + Intronic
1058612145 9:106788856-106788878 TGAGGGATAATGAGGGAGGTTGG - Intergenic
1059352944 9:113678489-113678511 GAAGGGAAACGGAGGAAGGAAGG - Intergenic
1059408395 9:114116595-114116617 GGAGAGGAACCGTGGGAGGCGGG - Intergenic
1060225878 9:121790624-121790646 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1060552480 9:124492242-124492264 GTAGGGAAAGAGAGGGAGGGGGG - Intronic
1060720915 9:125976787-125976809 GGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1060730448 9:126033702-126033724 CGACGGAGACTGAGAGAGGCGGG + Intergenic
1060738182 9:126079819-126079841 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1060896750 9:127223829-127223851 GCTGGGAAACTGAGGCAGTCCGG - Intergenic
1060988667 9:127835968-127835990 GTTGGGAAACTCAGGGGGGCTGG + Intronic
1061028868 9:128067982-128068004 CGATTCAAACTGAGGGAGGCGGG - Intronic
1061061756 9:128254113-128254135 GAAGGGACCCTGGGGGAGGCAGG - Intronic
1061196413 9:129109546-129109568 GCAGGGAAACTGAGGCAAGGAGG - Intronic
1061206546 9:129167189-129167211 GGAGGGTGCCTGAGGGAGGGAGG - Intergenic
1061218945 9:129237731-129237753 GTTGGGAAACTGAGGCAGCCAGG - Intergenic
1061252823 9:129436607-129436629 GGAGGGAGACTGAGGCAGCTCGG + Intergenic
1061414366 9:130438388-130438410 GGAGGGAAAAGTGGGGAGGCAGG - Intergenic
1061423230 9:130483585-130483607 GGAGGGAAGCCGAGGGAGGCCGG + Intronic
1061430244 9:130526316-130526338 GGAGGGAGACTGAGGCTGCCTGG + Intergenic
1061582806 9:131547796-131547818 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1061634858 9:131901082-131901104 GGAGAGAGAATGAGGGAGGGAGG + Intronic
1061743284 9:132722702-132722724 GGAGGGGAGCTGAGGGCAGCTGG - Intergenic
1061841057 9:133358820-133358842 GGAGGGAAATGGACAGAGGCTGG + Intronic
1061887988 9:133602432-133602454 GGAGGGAAGCAGGGGGAGGGAGG - Intergenic
1061897933 9:133658276-133658298 GGAGGTAAACTGAGGCTGGAGGG - Intronic
1061977665 9:134078774-134078796 GGAGGAAGAAAGAGGGAGGCAGG - Intergenic
1062008510 9:134254386-134254408 GGAGGGAGAAGGAGGGAGGGAGG + Intergenic
1062218209 9:135400368-135400390 GGAGGGAAACTGAGGCAGGCTGG - Intergenic
1062391769 9:136336715-136336737 GGAGGGATGGTGAGGGAGGGCGG + Intronic
1062451824 9:136618951-136618973 GGAGGGAGTGTGAGGGAGGCGGG + Intergenic
1062453717 9:136626233-136626255 GGAGGGCAGCTGAGGGAGCCAGG + Intergenic
1062480947 9:136751062-136751084 GGAGAGAGAGAGAGGGAGGCAGG + Intergenic
1062532244 9:137007088-137007110 GGAGGGAAACTGAGGCAGGGTGG - Intergenic
1062555646 9:137112464-137112486 GGAGGGCAACAGAGGGCAGCAGG - Intronic
1062613689 9:137386776-137386798 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613707 9:137386834-137386856 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613738 9:137386921-137386943 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613747 9:137386950-137386972 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062613777 9:137387037-137387059 GCAGGGGTGCTGAGGGAGGCAGG - Intronic
1062746412 9:138215662-138215684 GGAAGGAAACTGTGGCTGGCTGG - Intergenic
1203589504 Un_KI270747v1:41518-41540 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1185473710 X:400490-400512 GGAGGGCAGCTGGGGGAGGGAGG + Intergenic
1185485842 X:481512-481534 GGAAGGAGACAGAGGGAGGAAGG + Intergenic
1185586311 X:1244354-1244376 GGAGGGAAAGAGAGGAAGGAAGG + Intergenic
1185824049 X:3232076-3232098 GGAGAGAAAGGGAGGGAGGGAGG + Intergenic
1185972674 X:4682103-4682125 GGAAGGAAAGGGAGGGAGGGAGG + Intergenic
1186113172 X:6277331-6277353 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1186423192 X:9443124-9443146 GGAGGGAGACTTGGAGAGGCAGG + Intergenic
1186776047 X:12865642-12865664 GGAGGGAGCCAGAGGGAGGCAGG + Intergenic
1186783790 X:12940452-12940474 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1186854004 X:13608507-13608529 GGAGAGAAATAGAGGGAGGAAGG - Intronic
1187013433 X:15302905-15302927 GGAGGGAAGAGGAGGGAAGCAGG + Intronic
1187100176 X:16183831-16183853 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1187447663 X:19373111-19373133 GGAGGGAAGGTGAGGGGGACAGG + Intronic
1187505415 X:19874868-19874890 TGAGAGAAAGTGAGGGAGACAGG + Intronic
1187704290 X:21993960-21993982 GGAGGGAAAGTTAGGGTAGCGGG - Intronic
1188857915 X:35220477-35220499 GGAGAGAAAGAGAGGGAGGGAGG - Intergenic
1189051941 X:37654624-37654646 GGAGGGAAAGAGAGGGACGGAGG + Intronic
1189104036 X:38219192-38219214 GGAGGAGAACGGAGGGAGGTCGG + Intronic
1189215568 X:39320232-39320254 GGATGGAAACTGTGGCAGCCAGG + Intergenic
1189218696 X:39351097-39351119 CAAGGGAAAGTGTGGGAGGCGGG - Intergenic
1189356569 X:40314107-40314129 GCAGGAAGACTGAGGGATGCTGG + Intergenic
1189567913 X:42262470-42262492 GCAGAGAAATTTAGGGAGGCTGG - Intergenic
1189874814 X:45424806-45424828 GGGGGGAAAGGGAGGGAGGTAGG + Intergenic
1190459720 X:50660537-50660559 GGAGGGAGAGAGAGGGAGGGAGG - Intronic
1190713744 X:53087565-53087587 AGAGGGAGATGGAGGGAGGCAGG - Intronic
1190813636 X:53908912-53908934 GGAGGGAGAGGGAGGGAGGGAGG + Intergenic
1190845440 X:54186538-54186560 AGAGGGAAAATGAGGGAGTAGGG + Intergenic
1191221216 X:57989978-57990000 AGTGGGAGACTGAGGGGGGCTGG + Intergenic
1191866725 X:65709835-65709857 GGAAGGAAACTAAGGGGGGGTGG - Intronic
1192451540 X:71248087-71248109 GGAGGAGAAGGGAGGGAGGCCGG - Intronic
1192539433 X:71955709-71955731 GGAGGGAAAATGACAGAGGATGG + Intergenic
1192570620 X:72201093-72201115 GGAGGGAGGCTGAGGCAGGAGGG + Intronic
1192603860 X:72493139-72493161 GGAGGCAAAGTCAGGGAGGTGGG + Intronic
1193037844 X:76972757-76972779 GGAGGGGGGCTGTGGGAGGCAGG + Intergenic
1193218842 X:78898772-78898794 GAAGGGACACTGGGAGAGGCTGG + Intergenic
1193885672 X:86982460-86982482 TGAGGGATAGTGAGGGAGACTGG - Intergenic
1193941176 X:87682305-87682327 TGAGGGATAGTGAGGGAGGTAGG - Intergenic
1194293873 X:92105243-92105265 TGAGGGATAATGAGGGAGGTTGG + Intronic
1194308816 X:92278169-92278191 TGAGGGATAGTGAGGGAGGTTGG + Intronic
1194366826 X:93023544-93023566 TGAGGGATAGTGAAGGAGGCTGG - Intergenic
1194503274 X:94703979-94704001 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1194936160 X:99951571-99951593 GGAAGGAAAGGGAGGGAGGTAGG - Intergenic
1195908936 X:109870226-109870248 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1196299761 X:114040664-114040686 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1196533815 X:116817578-116817600 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1196774136 X:119322844-119322866 TGAGGGATAGTGAGGGAAGCTGG + Intergenic
1196834486 X:119801906-119801928 GGAGGGAAAGAGAAGGAGGGAGG - Intergenic
1196913236 X:120505556-120505578 GGAGGGAAAGGGAAGGAGGGAGG - Intergenic
1197064630 X:122222630-122222652 AGAGGGATAGTGAGGGAGGTTGG - Intergenic
1197820429 X:130536072-130536094 TGTGGGAAACTCAGGGAGACAGG - Intergenic
1197932797 X:131712622-131712644 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1198101498 X:133426151-133426173 GGAGGGAGACTGAGGTGGGAGGG - Intergenic
1198116495 X:133549764-133549786 GGAGGGAGAGAGAGGGAGGAAGG - Intronic
1198311819 X:135432522-135432544 GGAGGGAAGCAGAGGCAGGGGGG - Intergenic
1198598147 X:138259235-138259257 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1198599677 X:138269434-138269456 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1199308826 X:146298491-146298513 GGAGGGAAAATAAGGGAGGAAGG - Intergenic
1199576176 X:149316208-149316230 TGAGGGATAGTGAGGGAGGTTGG - Intergenic
1200232046 X:154448993-154449015 CCACGGAACCTGAGGGAGGCTGG - Intronic
1200533140 Y:4360585-4360607 TGAGGGATAGTGAGGGAGGTTGG + Intergenic
1200929826 Y:8686999-8687021 GGAGGGAAATGGAGTGATGCTGG - Intergenic
1201146441 Y:11067569-11067591 GGAGAGAAAGTAAGGGAGGGAGG + Intergenic
1201146561 Y:11067953-11067975 GGAGGGAAGGAGAGGGAGGGAGG + Intergenic
1201241577 Y:11961983-11962005 GCAGAGAAATTGAGGGATGCTGG - Intergenic
1201565358 Y:15359832-15359854 TGTAGGAGACTGAGGGAGGCAGG - Intergenic
1202368010 Y:24179889-24179911 TGAGGGAACCTGGGGAAGGCAGG + Intergenic
1202502773 Y:25490228-25490250 TGAGGGAACCTGGGGAAGGCAGG - Intergenic