ID: 1160716645

View in Genome Browser
Species Human (GRCh38)
Location 19:579798-579820
Sequence CCCTCCCTGGGGTTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 272}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160716645_1160716660 22 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716660 19:579843-579865 GCAGGGGGCTCCAGCAGCCCTGG 0: 1
1: 0
2: 6
3: 64
4: 565
1160716645_1160716654 0 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716654 19:579821-579843 GTCTGAGGGGCGTCCTTGTGAGG 0: 1
1: 0
2: 2
3: 186
4: 6348
1160716645_1160716661 26 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716661 19:579847-579869 GGGGCTCCAGCAGCCCTGGCAGG 0: 1
1: 0
2: 4
3: 78
4: 508
1160716645_1160716657 6 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716657 19:579827-579849 GGGGCGTCCTTGTGAGGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1160716645_1160716656 5 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716656 19:579826-579848 AGGGGCGTCCTTGTGAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 109
1160716645_1160716658 7 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716658 19:579828-579850 GGGCGTCCTTGTGAGGCAGGGGG 0: 1
1: 0
2: 3
3: 24
4: 164
1160716645_1160716655 4 Left 1160716645 19:579798-579820 CCAGAGGGAAACCCCAGGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 272
Right 1160716655 19:579825-579847 GAGGGGCGTCCTTGTGAGGCAGG 0: 1
1: 0
2: 2
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160716645 Original CRISPR CCCTCCCTGGGGTTTCCCTC TGG (reversed) Intronic