ID: 1160719141

View in Genome Browser
Species Human (GRCh38)
Location 19:589939-589961
Sequence CCCCGCGCGCGTCCATGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 3, 1: 0, 2: 0, 3: 7, 4: 63}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160719141_1160719159 23 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719159 19:589985-590007 CCGGGCGCGACCCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 254
1160719141_1160719149 -7 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719149 19:589955-589977 CGCGGGGGCGGCGGGCGGCCCGG 0: 3
1: 1
2: 23
3: 181
4: 1154
1160719141_1160719151 -5 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719151 19:589957-589979 CGGGGGCGGCGGGCGGCCCGGGG 0: 4
1: 2
2: 20
3: 172
4: 1184
1160719141_1160719157 22 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719157 19:589984-590006 CCCGGGCGCGACCCCCGCGCCGG 0: 1
1: 0
2: 6
3: 24
4: 190
1160719141_1160719153 5 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719153 19:589967-589989 GGGCGGCCCGGGGAGAGCCCGGG 0: 1
1: 1
2: 2
3: 72
4: 530
1160719141_1160719150 -6 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719150 19:589956-589978 GCGGGGGCGGCGGGCGGCCCGGG 0: 4
1: 2
2: 18
3: 275
4: 1479
1160719141_1160719152 4 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719152 19:589966-589988 CGGGCGGCCCGGGGAGAGCCCGG 0: 2
1: 0
2: 3
3: 48
4: 422
1160719141_1160719160 24 Left 1160719141 19:589939-589961 CCTCGCCATGGACGCGCGCGGGG 0: 3
1: 0
2: 0
3: 7
4: 63
Right 1160719160 19:589986-590008 CGGGCGCGACCCCCGCGCCGGGG 0: 1
1: 0
2: 3
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160719141 Original CRISPR CCCCGCGCGCGTCCATGGCG AGG (reversed) Exonic
900786778 1:4654690-4654712 CCCCGCGCGCCTCCTCCGCGCGG + Intergenic
901628810 1:10638537-10638559 CACCGCGCGCCACCAGGGCGGGG - Exonic
902600939 1:17539842-17539864 CGCCGCGGGCGCCCATGGCCGGG - Exonic
905414312 1:37794115-37794137 CCGGGCGGGCGGCCATGGCGCGG + Exonic
905803658 1:40861471-40861493 CCCCGCGCGCGCCCTCCGCGAGG - Exonic
914428548 1:147600030-147600052 CTCCGCTCGCGTCCGAGGCGGGG + Intronic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
1065588257 10:27240906-27240928 GACCGCGCGCGTCCTTGCCGCGG - Intronic
1066465033 10:35642895-35642917 CCCCTCGCGCGCCCAAGGCTGGG - Intergenic
1070830026 10:79412421-79412443 CCCCGCGTACGTACATGGTGTGG + Intronic
1070923855 10:80205401-80205423 CTCCGCGGGCGTCCCGGGCGCGG + Exonic
1075088791 10:119431315-119431337 CCCCGAGCTCCTCCAGGGCGGGG - Intronic
1077194549 11:1272588-1272610 CCACGCGCGCATCCATCGTGCGG - Intergenic
1081995414 11:47360537-47360559 CACCGCGCGCGGCCCTGGCTGGG - Intronic
1083303773 11:61752585-61752607 CCCCCCGCGCGTCCCTGGCCCGG - Intergenic
1104842300 12:131830869-131830891 CCCCCCGGGGGTCCTTGGCGGGG + Intronic
1119769825 14:77213564-77213586 CCCCGCCCGCTTCCTTCGCGCGG + Intronic
1121145470 14:91578385-91578407 CTCCGCCCGCGGCCCTGGCGTGG + Intergenic
1122697277 14:103562328-103562350 CCCCTCGCGCGCCCATTGTGAGG - Intronic
1122960987 14:105093541-105093563 CCCCGCGCGCATACCTGGCGAGG + Intergenic
1124500332 15:30222987-30223009 CCCCGCGCGCGTCCATGGCGAGG - Intergenic
1124743241 15:32315679-32315701 CCCCGCGCGCGTCCATGGCGAGG + Intergenic
1126137025 15:45402537-45402559 CCAAGCGCGCGCCCAGGGCGTGG - Exonic
1132897707 16:2236810-2236832 CCCGGGGCCCGCCCATGGCGCGG - Exonic
1141067123 16:80923077-80923099 CCCAGCGCTCCTCCATGGCTGGG - Intergenic
1142164617 16:88579532-88579554 CACCGCCCGCGCCCATGGTGCGG - Intronic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1142638325 17:1271102-1271124 CCCCGCACGCGCCCCTGGCACGG + Exonic
1143125698 17:4639913-4639935 CAGCGCGCTCGTCCAGGGCGCGG - Intronic
1143402777 17:6656910-6656932 CAGCGCGCTCGTCCAGGGCGCGG + Intergenic
1144347297 17:14360609-14360631 CACCGCGCCCGGCCATGGTGAGG + Intergenic
1154303922 18:13217528-13217550 CCCGGCGCGCGGCCAGGCCGCGG - Intronic
1160719141 19:589939-589961 CCCCGCGCGCGTCCATGGCGAGG - Exonic
1160767176 19:813814-813836 CCCGCAGCGCGTCCTTGGCGGGG + Exonic
1160937813 19:1605475-1605497 CCCCGCGCGCGTGCGCGCCGCGG - Exonic
1161509108 19:4660822-4660844 CCCAGCCCGAGTCCCTGGCGGGG - Intronic
1161584200 19:5096371-5096393 CACCGCGCCTGGCCATGGCGTGG + Intronic
1162410511 19:10502696-10502718 GCCGGAGCGCGGCCATGGCGGGG - Intronic
1165242856 19:34481705-34481727 CCCCGCGCGAGGCCGCGGCGAGG + Exonic
1166966758 19:46533705-46533727 CCCTGTGCGCGTCCATGTCCAGG - Intronic
930872672 2:56184350-56184372 CTCCGCGCAAGTCCATGGTGAGG - Exonic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
946248145 2:218398686-218398708 TCCCGCGGGCCTCCGTGGCGGGG - Intronic
1175443750 20:59007120-59007142 GCCGGCGCGGGGCCATGGCGAGG - Exonic
1175714640 20:61247322-61247344 CCCCGCCCGCCTCCCCGGCGTGG - Intergenic
1178518248 21:33266452-33266474 CCCAGCGTCCGTCCATGGCGTGG + Exonic
1185340056 22:50287162-50287184 CCCCGCCCGCGTGGAGGGCGAGG - Exonic
954186241 3:48919057-48919079 CTCCGCGCGCCTCCCTGGCCGGG + Exonic
961827302 3:129605898-129605920 CGCCGCGCGTGTCCAGGGAGCGG + Exonic
966181907 3:177196567-177196589 CCCCGGGCGCGTCCCCGGCCCGG - Intronic
968478825 4:825202-825224 CCCCGGGGGCGTGCATGGGGTGG + Intronic
977894216 4:102345575-102345597 TCCCGCGCGCGTCCACGCCGGGG + Intronic
985727325 5:1523299-1523321 CCCCGCGCTCGTCCCTGGTCCGG - Intronic
986152549 5:5140474-5140496 CCCCGCGCGCGCGGATGGCGGGG + Exonic
987088107 5:14487924-14487946 TAGCGCGCGCGTCCTTGGCGGGG - Exonic
989294877 5:39813968-39813990 CACCGCGCCCGGCCATGGTGGGG - Intergenic
1003942714 6:11044476-11044498 CCCCGCGCGCCCTCCTGGCGCGG - Intergenic
1006725421 6:36196559-36196581 CCCCCCGCCCGTGCCTGGCGCGG - Intergenic
1013366246 6:109440582-109440604 CCCCGGGCGCGGCCATGGCAAGG - Exonic
1019266688 7:121197-121219 CCGCGTGCTCGTCCAGGGCGGGG - Intergenic
1025261636 7:57424441-57424463 CCCCGCGCGGCCCCGTGGCGGGG - Intergenic
1038176279 8:25184522-25184544 CCTCGCGCGCTTCCCTGGAGCGG - Intergenic
1049762569 8:144337812-144337834 ACCCGCGCGCGGCCATTGTGCGG - Intergenic
1050546820 9:6716364-6716386 CCCAGCGATCGTCCATGGCCAGG - Intergenic
1051711399 9:19934529-19934551 CACCGTGCGCGCCCATGGCGGGG + Intergenic
1056386080 9:86098828-86098850 CCCGCCGCGCGTCCAGAGCGCGG - Intronic
1057613388 9:96567016-96567038 CCCCGCGCGCGACGAGGCCGTGG + Intronic
1060220466 9:121761635-121761657 CCCATCGCGGGTCCATGGGGAGG - Intronic
1060952329 9:127612206-127612228 CCCCGCGCGCGCCGGCGGCGGGG + Intergenic
1062656005 9:137605020-137605042 CCGCGCGGGCGTCCTGGGCGGGG - Intergenic
1190266889 X:48831969-48831991 CCCCGCGCCCGTCCCCGCCGCGG - Exonic
1200787708 Y:7274306-7274328 GCCCGGGCGCCTCCATGGGGAGG - Intergenic
1201416485 Y:13752909-13752931 CCCCGCGGGGGTCCATGCCACGG - Intergenic