ID: 1160719589

View in Genome Browser
Species Human (GRCh38)
Location 19:591312-591334
Sequence CGTGACCGCGGCGGGGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160719580_1160719589 3 Left 1160719580 19:591286-591308 CCGTGGGCTGTGTGTGAACAGGG 0: 1
1: 1
2: 4
3: 47
4: 313
Right 1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 57
1160719577_1160719589 5 Left 1160719577 19:591284-591306 CCCCGTGGGCTGTGTGTGAACAG 0: 1
1: 0
2: 1
3: 16
4: 130
Right 1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 57
1160719578_1160719589 4 Left 1160719578 19:591285-591307 CCCGTGGGCTGTGTGTGAACAGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 57
1160719573_1160719589 29 Left 1160719573 19:591260-591282 CCGGAGAGCGAGACCGGCGCGTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 57
1160719576_1160719589 16 Left 1160719576 19:591273-591295 CCGGCGCGTGTCCCCGTGGGCTG 0: 1
1: 0
2: 1
3: 10
4: 91
Right 1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG 0: 1
1: 0
2: 1
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160719589 Original CRISPR CGTGACCGCGGCGGGGTTCC CGG Intronic
1076446617 10:130518560-130518582 CGTGACCGTGGCGGCCTTGCTGG + Intergenic
1078139672 11:8682959-8682981 CGGGCCCGGGGCGGGGCTCCCGG + Intronic
1080445479 11:32333809-32333831 GGTAAGCGCTGCGGGGTTCCCGG - Intergenic
1081804979 11:45885605-45885627 CGAGACCCCGGCCGGGTCCCGGG + Intergenic
1083845959 11:65333807-65333829 CGGGACCGCACCGGGGTACCAGG - Exonic
1084172961 11:67409485-67409507 TGTGGCCGGGGCGGGGGTCCCGG - Exonic
1084758109 11:71251870-71251892 GGTGACCGCAGCGGGGTCTCGGG + Intronic
1084936729 11:72590685-72590707 TGGGACGGCGGCGGGGTCCCTGG - Intronic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1102527112 12:113520051-113520073 CGTGCCAGCCGCGGGGATCCTGG + Intergenic
1102962040 12:117099283-117099305 GGTGCCCGCGGCGGGGGCCCCGG + Exonic
1106250825 13:27980447-27980469 GGTGAGCGCGGAGGGGATCCGGG - Intronic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1116817855 14:49599766-49599788 CGGGGCCGGGGCGGGGATCCGGG + Intronic
1122418784 14:101562804-101562826 CCTGAGCGCAGCTGGGTTCCAGG + Exonic
1122807578 14:104267923-104267945 TGTGACCGCGGCCGGGTGCTGGG + Intergenic
1129708110 15:77806151-77806173 CCTGACCACGGAGGGCTTCCCGG + Intronic
1132407765 15:101554669-101554691 CCTTCCCGGGGCGGGGTTCCAGG - Intergenic
1134150027 16:11797863-11797885 CGTGCCCGCAGCGGGGCACCTGG - Intergenic
1135335859 16:21600074-21600096 CGGGGCCGCGGCCGGGTGCCCGG - Intronic
1141964344 16:87431799-87431821 TGGGACCGCTGCTGGGTTCCAGG + Intronic
1142697700 17:1643075-1643097 GGTGGCCGCGGCGGGGCGCCGGG - Intronic
1147765659 17:42833883-42833905 CGTGTCCGCGGAGGTGTCCCCGG - Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152751537 17:82064779-82064801 CGCGGCCGCGGTTGGGTTCCCGG - Intronic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG + Intronic
1164594370 19:29524341-29524363 CAGGACCACAGCGGGGTTCCAGG - Intergenic
1165922410 19:39307435-39307457 CGTGCCCAGGGCGGGGTTCGGGG - Exonic
1166033858 19:40153126-40153148 GGGGAACACGGCGGGGTTCCTGG + Intergenic
929966840 2:46542822-46542844 CGGGGCCGGGGCGGGGATCCGGG + Exonic
935634767 2:105241987-105242009 GATGACCGTGGTGGGGTTCCTGG + Exonic
938301121 2:130213696-130213718 CGGGGCCGGGGCGGGGATCCTGG - Intergenic
938455595 2:131460771-131460793 CGGGGCCGGGGCGGGGATCCTGG + Intergenic
940293494 2:152099200-152099222 CGCGCTCGCGGCGGGGTCCCGGG + Intergenic
944155304 2:196601463-196601485 CATGACAGCGGCTGGGTTGCTGG + Intergenic
948402278 2:237692553-237692575 CGTGACTGCGGCGGGGTTTCAGG + Intronic
1168777721 20:462212-462234 CGGGGCTGCTGCGGGGTTCCGGG - Intronic
950450132 3:13060712-13060734 CCTGCCCCCGGCGGGGCTCCAGG + Intronic
952467301 3:33603071-33603093 CGTGAACGCTGCAGGCTTCCTGG + Exonic
967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG + Intergenic
968133631 3:196207469-196207491 CGTGTCCGCCGCGGGCCTCCTGG - Exonic
968794012 4:2689989-2690011 CGTGACCACGGTCGGGTGCCCGG + Intronic
969295844 4:6270274-6270296 CCCGCCCGCGGCGGGGCTCCAGG - Intronic
969487989 4:7482843-7482865 GGTGTCCGCGGCGGGGATACAGG - Intronic
976169062 4:82284968-82284990 GGTGACCGGGGCGGGGCTTCGGG - Intergenic
982214133 4:153065519-153065541 CGTGACCGAGCCTGGCTTCCTGG + Intergenic
985632109 5:1019104-1019126 AGTGACCGGGGCGGTGGTCCTGG + Intronic
987286799 5:16465521-16465543 AGTGACCGCCGAGGGCTTCCAGG - Exonic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1019446415 7:1073881-1073903 CGTGACAGCAGCGGGGTGCGGGG - Intronic
1019446425 7:1073911-1073933 CGTGACGGCGGCGGGGTGCGGGG - Intronic
1019446497 7:1074126-1074148 CGTGACGGCAGCGGGGTGCGGGG - Intronic
1019446508 7:1074156-1074178 CGTGACGGCGGCGGGGTGCGGGG - Intronic
1019446527 7:1074215-1074237 AGTGACGGCGGCGGGGTGCGGGG - Intronic
1029351379 7:100015541-100015563 CGGGACCGCGCCGCGCTTCCGGG - Intergenic
1029549914 7:101232281-101232303 CGTGGCCGGGGCGGGGCTACGGG + Exonic
1030884703 7:114922748-114922770 GTTGACAGCGGCGGGGTCCCAGG - Intronic
1032159909 7:129502415-129502437 GGTGAGCGGAGCGGGGTTCCGGG - Intergenic
1039945949 8:42128896-42128918 GGTCACCGTGGCGGGCTTCCTGG + Intergenic
1049146019 8:141001466-141001488 AGTGACCGCGCCGGGGTTTCGGG + Intronic
1060583368 9:124771056-124771078 CGGGGGCTCGGCGGGGTTCCTGG - Exonic
1189323186 X:40098188-40098210 CGCCTCCGCGGCGGGGTTTCGGG + Intronic