ID: 1160719829

View in Genome Browser
Species Human (GRCh38)
Location 19:592233-592255
Sequence CTGTCGAAGGTCATGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160719829_1160719842 13 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719842 19:592269-592291 GCAGCGTGGGGGCTGGCAGGTGG 0: 1
1: 0
2: 5
3: 85
4: 764
1160719829_1160719837 1 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719837 19:592257-592279 GATGGGTGCACCGCAGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1160719829_1160719836 0 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719836 19:592256-592278 AGATGGGTGCACCGCAGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 44
1160719829_1160719838 2 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719838 19:592258-592280 ATGGGTGCACCGCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1160719829_1160719835 -1 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719835 19:592255-592277 GAGATGGGTGCACCGCAGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 71
1160719829_1160719839 6 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719839 19:592262-592284 GTGCACCGCAGCGTGGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 195
1160719829_1160719840 10 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719840 19:592266-592288 ACCGCAGCGTGGGGGCTGGCAGG 0: 1
1: 0
2: 1
3: 21
4: 211
1160719829_1160719843 16 Left 1160719829 19:592233-592255 CCCTCCAGCATGACCTTCGACAG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1160719843 19:592272-592294 GCGTGGGGGCTGGCAGGTGGAGG 0: 1
1: 2
2: 3
3: 93
4: 900

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160719829 Original CRISPR CTGTCGAAGGTCATGCTGGA GGG (reversed) Intronic
900033127 1:385619-385641 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
900053966 1:615509-615531 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904513422 1:31033607-31033629 CTTTAGGAGGCCATGCTGGATGG - Intronic
904768604 1:32869081-32869103 CTGGGGAAGGCCATGCAGGAGGG + Intronic
906684244 1:47752720-47752742 CTCTTGAAAGTCCTGCTGGATGG + Intergenic
913255899 1:116953371-116953393 CTGTCCAAGATTATTCTGGAAGG + Intronic
917369167 1:174270164-174270186 TTCTCTAAGGTCATGCTGGTTGG + Intronic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
917816617 1:178716808-178716830 TTGTCCAAGGTCATGCTGCTAGG - Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
923619652 1:235568040-235568062 CTTTATAGGGTCATGCTGGAGGG - Intronic
924336690 1:242992639-242992661 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1062948357 10:1477398-1477420 CTGTATAGGGTCATGCTGGAGGG - Intronic
1063622074 10:7658866-7658888 GTGTTGATGTTCATGCTGGAGGG + Intronic
1070741026 10:78903434-78903456 CTGCCCAAGGTCATGCTGCAAGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076042185 10:127259683-127259705 CTGACAAAGGTCAGGCGGGATGG + Intronic
1081551061 11:44113000-44113022 CTGCCCAAGTTCATGTTGGATGG + Intronic
1081982364 11:47275955-47275977 CTCTCGAAGGTCATGCAGAAGGG - Exonic
1087044530 11:93833806-93833828 CTGTCCACGGGTATGCTGGAGGG - Intronic
1088464817 11:110123953-110123975 CAGTCCCAGGCCATGCTGGAGGG + Intronic
1088577633 11:111287114-111287136 CTTTGGAAGGCCATGGTGGATGG - Intergenic
1089430542 11:118420626-118420648 CTGAAGGAGTTCATGCTGGATGG - Intronic
1089799995 11:121019790-121019812 CTTTGGAAGGTCAAGGTGGAAGG + Intergenic
1091843418 12:3636714-3636736 ATGTGGAAGGGCATGCAGGAGGG + Intronic
1098209069 12:68143465-68143487 CTGAAGAAGGTCCTGCTGGTTGG + Intergenic
1098237000 12:68426976-68426998 ATGCCCAAGGTCATGCTGGATGG + Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1104307794 12:127625148-127625170 GTGTCGATGTTAATGCTGGAGGG + Intergenic
1104539179 12:129646341-129646363 CTGTCTAAGGCAATGCTGGTAGG + Intronic
1106234275 13:27848522-27848544 TTGTGGAAGGTCCAGCTGGAAGG + Intergenic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1114266668 14:21076386-21076408 CTGACGAAGGTCCAGCAGGACGG - Exonic
1114778508 14:25513622-25513644 CTGTCTCAGGACATCCTGGAAGG - Intergenic
1117386440 14:55218472-55218494 CTGTAAAAGGTCATGGTTGAGGG + Intergenic
1122589541 14:102837380-102837402 CTTTGGAAGGTCAAGGTGGAAGG - Intronic
1132878328 16:2149932-2149954 TTGTCCTAGGTCATGCTGGTGGG + Exonic
1133021493 16:2968924-2968946 CTGTCCAAGGTGCTGCCGGACGG - Intronic
1135256577 16:20946128-20946150 GTGTTGATGGTAATGCTGGAGGG - Intronic
1136925698 16:34371575-34371597 ATGTCTAAGGTCAGGCTGGCTGG + Intergenic
1136978876 16:35040231-35040253 ATGTCTAAGGTCAGGCTGGCTGG - Intergenic
1137651023 16:50120403-50120425 CTTTGGGAGGTCAAGCTGGAAGG - Intergenic
1140528975 16:75648006-75648028 CTGTCGACGCTCATCCTGCACGG + Exonic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143864040 17:9911186-9911208 CTGCTGCAGGTGATGCTGGAAGG + Intronic
1143887919 17:10079414-10079436 GTGTTGAAGTTAATGCTGGAGGG - Intronic
1148494032 17:48041719-48041741 ATGTCAATGGTCATGCTGGCTGG + Intergenic
1148687695 17:49509753-49509775 CTGTCCAAGGGCTGGCTGGAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1160719829 19:592233-592255 CTGTCGAAGGTCATGCTGGAGGG - Intronic
1162746976 19:12804265-12804287 CAGTCGAAGGGCTTGCAGGATGG - Intronic
1163420070 19:17209420-17209442 CTGCCGAAGGTCACACTGCATGG + Intronic
1164560421 19:29288309-29288331 CAGACAATGGTCATGCTGGAAGG + Intergenic
1165597635 19:37024008-37024030 GTGTTGATGTTCATGCTGGAGGG - Intronic
926572641 2:14546310-14546332 TTGTCCAAGGTCATGCAGAAAGG + Intergenic
928265851 2:29811171-29811193 AGGTCGAAGGCCAGGCTGGAGGG + Intronic
929298608 2:40275818-40275840 CTGCTGGAGGTCAGGCTGGATGG + Intronic
931075764 2:58709853-58709875 CTGTCTAAGGTGGTGCTGCAGGG + Intergenic
932083620 2:68737938-68737960 CTGAAGAGGGTCTTGCTGGATGG + Intronic
935407954 2:102728739-102728761 ATGTCCGAGGTCATGGTGGAAGG - Intronic
940129014 2:150360323-150360345 TTGTCAAAAGTCATGATGGATGG + Intergenic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
948862894 2:240761442-240761464 CTCTGGAAGGTCAGGCTGGTCGG + Intronic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1171112760 20:22499678-22499700 CTGCCAAAGGGCATGCTGGATGG + Intergenic
1172118982 20:32586504-32586526 CTGCTCAAGGTCATGCAGGAAGG + Intronic
1172536870 20:35680680-35680702 CTATCAAAGGTCTTGCTGGAAGG + Intronic
1173994861 20:47330123-47330145 CTCACGAAGGTCAGTCTGGAAGG + Intronic
1175242045 20:57556904-57556926 CTGTAGAATGCCATGCAGGATGG - Intergenic
1180868072 22:19131039-19131061 CTGTCACAAGTCAAGCTGGAGGG - Exonic
1181861631 22:25823592-25823614 CTGTCGAAGGTGGTGCTTGAAGG - Exonic
1182353247 22:29710587-29710609 CTATCCAAGGTCAGGCGGGAGGG - Intergenic
1183282388 22:36938548-36938570 CTGAGGAAGGTCAGGCGGGAGGG - Exonic
954920191 3:54184055-54184077 CTGTCCCAGGTCAAGCTTGAAGG + Intronic
963641469 3:147865689-147865711 TTTTATAAGGTCATGCTGGAGGG - Intergenic
964599992 3:158488951-158488973 CTGCCTAAGGTCATGCTTTATGG + Intronic
968879267 4:3290890-3290912 GTGTCAAGTGTCATGCTGGAAGG - Intergenic
972765657 4:42151131-42151153 CTGTCGCAGTCCATGCTGGCTGG - Intronic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
977021727 4:91768697-91768719 CTTTAGAGGGTCATGCTGGAGGG + Intergenic
982366730 4:154586870-154586892 TTGTCGAGGGTCATGCAGTAGGG - Exonic
986219335 5:5753479-5753501 GTGTTGATGTTCATGCTGGAAGG + Intergenic
987321087 5:16770009-16770031 CTTTGGAAGGCCAAGCTGGAAGG - Intronic
989445999 5:41529143-41529165 CTGTTGATGCTAATGCTGGAGGG - Intergenic
992539553 5:77751075-77751097 CTGTTGATGTTAATGCTGGAGGG + Intronic
992540495 5:77759390-77759412 CTGTTGATGTTAATGCTGGAGGG + Intronic
998757899 5:145400805-145400827 CTGTCCCAGGTCATGGTTGATGG - Intergenic
1001315600 5:170639185-170639207 GAGTCGAATGTCATTCTGGAGGG - Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1012358025 6:98340559-98340581 CTGTCGAGGGTCACCCTGTAGGG - Intergenic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013615211 6:111836519-111836541 CTTTCGAAGGTCAAGGTGGGAGG + Intronic
1015614852 6:135064030-135064052 GTGTTGAAGTTAATGCTGGAGGG - Intronic
1016989305 6:149918457-149918479 CTGACCCAGGTCATCCTGGAAGG + Intronic
1017359303 6:153547283-153547305 GTGTCGATGTTAATGCTGGAGGG - Intergenic
1019245803 6:170708845-170708867 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1020181527 7:5926387-5926409 CTGGTGATGGTCTTGCTGGATGG + Exonic
1020301406 7:6798502-6798524 CTGGTGATGGTCTTGCTGGATGG - Exonic
1021362245 7:19730011-19730033 CTTTGGGAGGTCATGGTGGACGG + Intronic
1024825504 7:53385719-53385741 CTGATGAAGGTCATGCTGAGAGG - Intergenic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1035502321 8:99353-99375 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic
1037346285 8:17904868-17904890 CTGCAGAAGGTAATGATGGATGG + Intronic
1038561891 8:28588031-28588053 CTGTACAAGGTCATGCTAGAAGG + Intergenic
1041820910 8:62031953-62031975 TTTTATAAGGTCATGCTGGAAGG + Intergenic
1042794141 8:72641702-72641724 CTGCCCAAGGTCATGCTGCTAGG - Intronic
1047157737 8:122340140-122340162 TTGGCCAAGGTCATGCAGGAGGG + Intergenic
1050867516 9:10521652-10521674 TTGTCGAAGGTTAGGGTGGATGG - Intronic
1051212485 9:14759264-14759286 CTTTCGAAGGCCAAGGTGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1053729577 9:41039611-41039633 CTGTCCAGGGCCATGCTGGTTGG + Intergenic
1054698930 9:68392451-68392473 CTGTCCAGGGCCATGCTGGTTGG - Exonic
1059056063 9:110981317-110981339 CTGCCCAAGGTCATACTGGCAGG - Intronic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1061419364 9:130464769-130464791 AGGTCCAAGGTCAAGCTGGAGGG - Intronic
1203606001 Un_KI270748v1:58056-58078 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1188904136 X:35772273-35772295 CTGTTGATGGTAATACTGGAGGG + Intergenic
1191069484 X:56384644-56384666 GTGTCGATGTTAATGCTGGAGGG + Intergenic
1191871597 X:65751021-65751043 TTTTATAAGGTCATGCTGGAGGG - Intergenic
1193936849 X:87633779-87633801 CTGTAGGTGGTCATGATGGATGG + Exonic
1197277952 X:124501836-124501858 GTGTCCAAGGTCAGGCTGAAAGG + Intronic
1202388168 Y:24344493-24344515 CTGCAGAAGGTCTGGCTGGAAGG + Intergenic
1202482619 Y:25325635-25325657 CTGCAGAAGGTCTGGCTGGAAGG - Intergenic