ID: 1160720770

View in Genome Browser
Species Human (GRCh38)
Location 19:596026-596048
Sequence TCCAAGGGGCTGAGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 298}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160720762_1160720770 -10 Left 1160720762 19:596013-596035 CCCTCCCCTGGGATCCAAGGGGC 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 298
1160720756_1160720770 1 Left 1160720756 19:596002-596024 CCCTGGGCAGGCCCTCCCCTGGG 0: 1
1: 0
2: 10
3: 99
4: 818
Right 1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 298
1160720758_1160720770 0 Left 1160720758 19:596003-596025 CCTGGGCAGGCCCTCCCCTGGGA 0: 1
1: 0
2: 4
3: 91
4: 494
Right 1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 298
1160720753_1160720770 3 Left 1160720753 19:596000-596022 CCCCCTGGGCAGGCCCTCCCCTG 0: 1
1: 1
2: 5
3: 61
4: 511
Right 1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 298
1160720754_1160720770 2 Left 1160720754 19:596001-596023 CCCCTGGGCAGGCCCTCCCCTGG 0: 1
1: 0
2: 4
3: 47
4: 498
Right 1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 298
1160720749_1160720770 20 Left 1160720749 19:595983-596005 CCAGCAGGGGCTGAAGACCCCCT 0: 1
1: 0
2: 7
3: 27
4: 198
Right 1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160720770 Original CRISPR TCCAAGGGGCTGAGGGTCCT GGG Intronic
900296714 1:1955608-1955630 TCCAGGGGGCTGAGGGGCCCAGG - Intronic
901399816 1:9008063-9008085 TCCACGGGTCCGGGGGTCCTAGG - Intronic
901492035 1:9601592-9601614 TCCCAGGGGCTGGGAGTCGTAGG + Intronic
903472136 1:23594706-23594728 GCCAACTGGCTGAGAGTCCTGGG + Intronic
903506461 1:23839060-23839082 TTTAAAGGGCAGAGGGTCCTGGG + Intergenic
903787704 1:25872354-25872376 TCCCAGGGCCTAAGGGCCCTTGG - Intergenic
903828159 1:26159735-26159757 TCCTGGAGGCTGAGGGACCTTGG - Intronic
904465273 1:30703989-30704011 TGCCTGGGGCTGAGGGGCCTTGG - Intergenic
904806826 1:33137939-33137961 GCCGAGGAGCTGAGGGTCCAGGG + Intergenic
905240049 1:36575635-36575657 ACCAAGGGGCTGGGGGGCATGGG - Intergenic
905340181 1:37272731-37272753 TCCAAGTGGCAGATGGTCCCAGG + Intergenic
905885148 1:41487756-41487778 TCCAAGGGACCCAGGATCCTGGG - Intergenic
906260162 1:44380786-44380808 GCCCACAGGCTGAGGGTCCTGGG + Intergenic
907076822 1:51586736-51586758 TCCACGAGGCTGAGGCCCCTTGG + Intronic
907932773 1:59015796-59015818 TCCAAGGGGATGGAGGTACTTGG - Intergenic
909719629 1:78753438-78753460 TCCAAGGTTCTGAGGCTGCTTGG - Intergenic
912556166 1:110517694-110517716 TCCAAGGGGCTGCAGATCCTCGG - Exonic
912575977 1:110673647-110673669 TCCAAGGGGCTGCAGATCCTCGG - Exonic
912715622 1:111981795-111981817 TCCCAGGGCCTGCGGATCCTGGG - Exonic
913201433 1:116497826-116497848 TCCAAGTGGGTGGGAGTCCTGGG + Intergenic
915095709 1:153460697-153460719 TCCCAGGGGCTGGGAGGCCTGGG + Exonic
918194127 1:182206101-182206123 TCCAAGGGGCTGGGGGTGAAAGG - Intergenic
919919845 1:202161323-202161345 TGCAGGGGGCTGAGGGCCCAGGG - Exonic
921091113 1:211844415-211844437 TCTAAAGAACTGAGGGTCCTGGG + Intergenic
922168116 1:223132514-223132536 TTCTAGGGGCAGAGGGTCCCTGG + Exonic
923829902 1:237543228-237543250 TCAAAGGGGCTGAGGGGTGTAGG + Intronic
1063031629 10:2240859-2240881 CCCATGGAGCTGAGTGTCCTGGG - Intergenic
1063439377 10:6060034-6060056 TCCAAGGGTCTGAGTGGTCTTGG - Intronic
1065958169 10:30711180-30711202 TTCAAAGGGCTAAGTGTCCTGGG + Intergenic
1070319891 10:75346735-75346757 TCAAAGAGGCTGAGGTTGCTGGG - Intergenic
1070391547 10:75975213-75975235 TCTAGGGGGCTGAAGGCCCTGGG + Intronic
1070546739 10:77458391-77458413 TCCAAGTGGCTGTGTGGCCTTGG - Intronic
1070931271 10:80262375-80262397 TCCAAAGAACTGAGGATCCTGGG + Intergenic
1071265196 10:83958403-83958425 TCCAAGGGGTTGAGGTTGCTAGG + Intergenic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1073179459 10:101575012-101575034 CCCCAGGGGCTGAGGGGCCATGG - Intronic
1073282673 10:102366169-102366191 TTCCAGGGGGTGAGGGTTCTAGG + Intronic
1073429879 10:103479151-103479173 TCCAAGGGCCTGAGGGGCCAAGG + Exonic
1074823875 10:117201052-117201074 GCAAAGGGGCTGCTGGTCCTTGG + Intronic
1076078551 10:127557130-127557152 TCCAAGGTGCTGAGGGGATTTGG + Intergenic
1076410234 10:130244194-130244216 GGGAAGGGGCTGTGGGTCCTGGG + Intergenic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076627730 10:131832252-131832274 TGGAAGGGGCTGAGGATGCTGGG - Intergenic
1076795008 10:132794140-132794162 TCCAGGGGGGTGAGGGCCCCCGG + Intergenic
1076874805 10:133210831-133210853 CCCAAGGGGGTGAGGGGCCAGGG + Intronic
1077266893 11:1655327-1655349 TCCAAGGGGCTGTCAGCCCTGGG - Intergenic
1077288744 11:1779203-1779225 CCCAAGGGGCAAAGAGTCCTGGG - Intergenic
1077309965 11:1883950-1883972 ACCAAGGGGCTGGGTGTCCTGGG - Exonic
1079883474 11:25955972-25955994 GCCAAAGGCCTGAGAGTCCTTGG - Intergenic
1080556770 11:33424538-33424560 TCTAAAGAACTGAGGGTCCTAGG - Intergenic
1080587433 11:33694618-33694640 TCCAAGGGGATGAGAGTTCCTGG + Intergenic
1083430341 11:62611108-62611130 TGCAAGGGCCTGAGGATCCCCGG + Exonic
1083758053 11:64801938-64801960 CCCGAGGGGCTGTAGGTCCTGGG - Intronic
1084326200 11:68401605-68401627 CCCAAGGGGCTCTGGGTCCTCGG - Intronic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084552351 11:69852390-69852412 TCCAAGAGGCTGAAGGTCTCAGG + Intergenic
1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG + Intronic
1090146960 11:124335301-124335323 TCCAGAGGGCTGGGAGTCCTAGG - Intergenic
1090380815 11:126326373-126326395 CACACGGGGCTGTGGGTCCTTGG + Intronic
1091025232 11:132135750-132135772 TGGAAGGGGCCGAGGGGCCTGGG + Intronic
1091211365 11:133864158-133864180 TCTGTGGGTCTGAGGGTCCTAGG + Intergenic
1091243065 11:134067465-134067487 TATAAGGGGCAGAGGTTCCTAGG - Intergenic
1091844507 12:3645496-3645518 GCCAAGGGGCTGGGGGTGGTGGG + Intronic
1091974136 12:4811116-4811138 TCCAAGGGGCTGCAGATCCTGGG + Exonic
1092002825 12:5045396-5045418 TCCAAGGGGCTGCAGATCCTGGG + Exonic
1096292038 12:50351506-50351528 TCCCAGGGGCAAAGGGGCCTTGG + Exonic
1096725328 12:53556760-53556782 GCCAGGGGGCTGTGGGTGCTTGG + Intronic
1101609642 12:106279049-106279071 TGCAAGGGGCTGAGCGTGGTGGG - Intronic
1102633534 12:114302513-114302535 TCCAAGGTGCTGCTGGGCCTTGG + Intergenic
1103735369 12:123057711-123057733 TACAAGCGGCTGAGCCTCCTGGG + Intronic
1104481686 12:129113326-129113348 TCCAGGGGGCAGATGGACCTAGG + Intronic
1105766025 13:23560377-23560399 TCTAAGAGGCTGAGGATACTGGG - Intergenic
1106773903 13:32990278-32990300 CTCAAGGGGCTGGGGGTGCTGGG - Intergenic
1108598511 13:51970856-51970878 GCCCAGGGGCTGAGGCTGCTCGG - Intronic
1113851474 13:113420981-113421003 TCCCAGGGGTTGGCGGTCCTGGG - Intergenic
1114355777 14:21906538-21906560 TCCCAGCTGCTCAGGGTCCTTGG - Intergenic
1115407647 14:33036236-33036258 CCCAAGGGGCTGTGAGTTCTGGG + Intronic
1118895390 14:69941460-69941482 ACGAAGGGGCTGGGTGTCCTGGG - Intronic
1120345603 14:83285705-83285727 CCTAAGGAACTGAGGGTCCTGGG - Intergenic
1120375492 14:83700316-83700338 TACCAGAGGCTGGGGGTCCTGGG + Intergenic
1121253680 14:92516668-92516690 TGCAAGGGGCTGGGGGTGCAGGG + Intronic
1121643208 14:95500210-95500232 TCCAAGGAGGTGAAGGTTCTGGG - Intergenic
1122070731 14:99203976-99203998 TGCAAGGGCCTGGGGGACCTGGG - Intronic
1122815314 14:104309373-104309395 TCTAAGGGGCCCTGGGTCCTGGG - Intergenic
1122860863 14:104581851-104581873 TTCCAGGGGCAGAGGGTCCCGGG - Intronic
1122898316 14:104771519-104771541 TCCAAGGGTATGGGGGGCCTGGG - Intronic
1123106749 14:105845319-105845341 TGGAAGGTGCTGGGGGTCCTGGG + Intergenic
1124200955 15:27678127-27678149 TCCAAGGTGAGGAGGATCCTGGG - Intergenic
1124721874 15:32117569-32117591 TCCTAGGACTTGAGGGTCCTAGG + Intronic
1125721071 15:41845458-41845480 CCCAAAGGGCTGAGGGACCCTGG - Intronic
1125728753 15:41881386-41881408 TCCTTGGGGCTGAGGGTCGAGGG + Intronic
1126919430 15:53504477-53504499 AACACGGGGCTGAGGTTCCTGGG + Intergenic
1127970024 15:63951310-63951332 TGCAAGGGGGTGCGGTTCCTGGG + Intronic
1133050995 16:3117330-3117352 CCCAAGGGTCTGCGGGGCCTGGG - Intronic
1133278404 16:4651633-4651655 AGGAAGGGGCTGAGGGTGCTCGG + Intronic
1134232152 16:12437668-12437690 TCCCAGGGACTCTGGGTCCTGGG - Intronic
1134607825 16:15584913-15584935 ACCAAGAGGCTGGGGGTACTGGG + Intronic
1134831969 16:17331105-17331127 GCCAAGGGGCTGTGGGGACTCGG - Intronic
1134903445 16:17959316-17959338 TACCAGGGGGTGGGGGTCCTTGG - Intergenic
1135949170 16:26896927-26896949 AGCAAGGGGATCAGGGTCCTGGG - Intergenic
1136997719 16:35202169-35202191 GCAAGGAGGCTGAGGGTCCTTGG + Intergenic
1137249748 16:46732844-46732866 TCCCACCGGATGAGGGTCCTGGG + Intronic
1140035435 16:71367973-71367995 TCCCAGAGGCTGAGGCTTCTTGG + Intronic
1140316483 16:73902821-73902843 CCCATGAGGCTGAGGGTCCAGGG + Intergenic
1141013637 16:80426950-80426972 TCCAGGGGGCTGAGGCTGCCAGG - Intergenic
1141677073 16:85523623-85523645 TCCAGGGGGCTGAGGGACAGAGG + Intergenic
1141834758 16:86531483-86531505 ACCCAGGGGCTGAGCTTCCTGGG + Exonic
1141862553 16:86727999-86728021 TCCTAAGGGCTGAGAGTCCGTGG + Intergenic
1141945668 16:87307872-87307894 TTGAAAGAGCTGAGGGTCCTGGG + Intronic
1142478499 17:204098-204120 TCCCAGAAGCTGTGGGTCCTCGG - Intergenic
1142928961 17:3266287-3266309 TCCCAGTGGCTGAGGGTATTTGG - Intergenic
1144855547 17:18265422-18265444 TTCAGGCAGCTGAGGGTCCTGGG + Exonic
1145184761 17:20784596-20784618 TTCCAGGGGCTGAGGCTCCGGGG - Intergenic
1145186294 17:20797323-20797345 TCCTAGGAGCTGAGGGGCCTAGG + Intergenic
1146683884 17:34827552-34827574 GGGAAGGGGCTGAGGGTCCTTGG - Intergenic
1147689293 17:42305726-42305748 TCCTAGGGCCTGGGGGTGCTGGG - Intronic
1148226057 17:45898452-45898474 TCCAAGGGCATGAGGGTCAAAGG - Intronic
1148344386 17:46893839-46893861 GGCCAGGGGCTGAGGGTCCCTGG + Intergenic
1148410820 17:47465525-47465547 TCCTAGGAGCTGAGGGGCCTAGG - Intergenic
1148561539 17:48609599-48609621 CCCAAGAGGCTGAGGTTCCATGG - Intronic
1148988907 17:51648250-51648272 GCCAAGGGGATGTGGGTGCTTGG + Intronic
1149203615 17:54217169-54217191 GCCAAGTGGCTGAGAGTTCTTGG - Intergenic
1151180259 17:72322222-72322244 TCCAGGGGGCTCAGGGTCTCTGG - Intergenic
1151425222 17:74026653-74026675 TGCAAGGGGGTGAGGGTCTAGGG + Intergenic
1151677670 17:75607229-75607251 TACCAGGGGCTGGGGGTCTTGGG - Intergenic
1151917458 17:77128844-77128866 TCCAAGGGGCTAGGGGTGCATGG - Intronic
1152222230 17:79075121-79075143 TCCGCGGGGCTGAGAGTCCGTGG + Intronic
1152394544 17:80024208-80024230 TCCAAGGGGCTGGGGTCCGTGGG - Intronic
1152423056 17:80204377-80204399 TCCAAGTGGGTGAGGGGCTTTGG + Intronic
1153378655 18:4411111-4411133 TCCAAGGGGCTGAGAGAAGTAGG - Intronic
1157537503 18:48470812-48470834 TCACAGGGGAGGAGGGTCCTGGG + Intergenic
1158494102 18:57938093-57938115 TCCAAAAGGCTGAGGGAGCTGGG - Intergenic
1159941641 18:74413017-74413039 GCCACGGAGATGAGGGTCCTGGG - Intergenic
1159996407 18:74969665-74969687 TGCAAGGGGAAGAGGGTCTTGGG + Intronic
1160155301 18:76429223-76429245 GCCAAGGGCCTGAGGGTCCCAGG + Intronic
1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG + Intronic
1160778643 19:868129-868151 TCCAGGGATCTGGGGGTCCTGGG + Exonic
1160811444 19:1014671-1014693 TCCAAGTGACTGAGGATCCGGGG + Intronic
1161067065 19:2243888-2243910 TCCACGGTGCTGAGGGGACTCGG - Intronic
1161391747 19:4024668-4024690 TCCCAGGAGCTGGGGGTCCCCGG + Intronic
1161473531 19:4472812-4472834 TCCCGGGGTCTGGGGGTCCTCGG + Intronic
1161473672 19:4473244-4473266 GCCAATGGTCTGGGGGTCCTGGG + Intronic
1161840975 19:6680100-6680122 TCCAGGGGCCTGAGAGTCCCAGG - Intronic
1163628301 19:18403550-18403572 TCCTGGGGCCTGAGGATCCTGGG + Intergenic
1163628315 19:18403582-18403604 TCCTGGGGACTGAGGGTCCTGGG + Intergenic
1163628336 19:18403646-18403668 TCCTGGGGCCTGAGGGTCCTGGG + Intergenic
1163649207 19:18507357-18507379 GCCAAGGGGCTGTGGGTCTGTGG - Intronic
1163726944 19:18928351-18928373 TCCATGGAGCTGAGGGTCGGAGG + Exonic
1165089753 19:33378348-33378370 TCCAAGGAAGTGCGGGTCCTGGG - Intronic
1165308102 19:35014300-35014322 TCCAAGGGGCCCAGGGTGGTGGG - Exonic
1165735752 19:38174386-38174408 GCCAAGTGGCTGGGGGCCCTCGG + Intronic
1165903321 19:39178797-39178819 TCCCAGAGGGTGGGGGTCCTGGG - Exonic
1167956707 19:53071253-53071275 CTCAAGAGGCTGAGGGTGCTGGG + Intronic
925135086 2:1521469-1521491 TCCCTGGGGAGGAGGGTCCTGGG - Intronic
925319867 2:2954706-2954728 TACAAAGGGGTGAGGGTCATTGG + Intergenic
925636362 2:5945192-5945214 TCAAAGGGACTGAGCTTCCTAGG - Intergenic
926690184 2:15727743-15727765 TCCCAGGTGCTGAAGGCCCTGGG + Intronic
927430771 2:23024712-23024734 GCCAGAGGGCTGAGGGGCCTTGG + Intergenic
927496321 2:23554056-23554078 TCCATGGGGCTGGGGGTCACTGG + Intronic
928600566 2:32900238-32900260 TCCAATGGGCAGAGGGGACTGGG - Intergenic
928683824 2:33728119-33728141 TCCACGGGGTGGCGGGTCCTGGG - Intergenic
929065357 2:37967883-37967905 TCTAAAGAACTGAGGGTCCTGGG - Intronic
929778536 2:44943148-44943170 TCCCAGGGGCTGCGGGTACTCGG - Intronic
930708483 2:54527693-54527715 TCCAAGGGGGCCAGGGACCTGGG - Intronic
931638557 2:64361971-64361993 TCCAAGGCGCTGAGCGTAGTAGG - Intergenic
931687745 2:64808961-64808983 GCCAAAGGCCTGAGGGCCCTGGG - Intergenic
931693826 2:64857821-64857843 TCCAATGGCCGGAGGGGCCTTGG + Intergenic
933799861 2:85952261-85952283 TCAAATGGGCTGAGTGTCCCAGG + Intergenic
934544806 2:95206046-95206068 AGCAAGGGGCTGTGGGTGCTGGG + Intergenic
934709879 2:96507986-96508008 TCCAAGGGGCGGAGTCTCCGCGG - Intronic
935466129 2:103400224-103400246 TGTAAGGGGCTGAGGGTCTCAGG - Intergenic
937246097 2:120494755-120494777 TCCAAGGTGCCCTGGGTCCTTGG + Intergenic
937355857 2:121197696-121197718 TCCCATGGACTGAGGGCCCTTGG + Intergenic
938422587 2:131156506-131156528 TCCTAGGGGCTGAGGGCCTGAGG - Intronic
938763604 2:134445833-134445855 CCCTAGGGGTTGAGGATCCTGGG + Intronic
939066616 2:137490756-137490778 TACTAGGGTCTGAGGGTCCCAGG + Intronic
940823772 2:158387145-158387167 TCCAAGGAGCTCTGGTTCCTTGG + Intronic
940986596 2:160057703-160057725 CCCAAGAGGCTGAGAGTCCAGGG - Intronic
943051071 2:182913933-182913955 ACCAAGAGGCTGAGGGTTGTGGG - Intronic
944491502 2:200262709-200262731 TGCATGGGGCTGTGGGGCCTTGG - Intergenic
945307195 2:208269629-208269651 GCCAAGGTGATGAAGGTCCTGGG - Intronic
946429996 2:219620810-219620832 TCCAAGGAGCTTATGGTCCAGGG + Intergenic
946433381 2:219637153-219637175 GCTAAGGGGCTGGGTGTCCTTGG + Intronic
947795795 2:232893248-232893270 TTCACGGGGCTGATGGTGCTGGG + Intronic
947808762 2:232986690-232986712 TGCCAAGGGCTGGGGGTCCTTGG + Intronic
948926002 2:241098454-241098476 TCAAAGTGGGTAAGGGTCCTTGG + Intronic
1169002589 20:2178765-2178787 GCCCAGGAGCTGAGGGCCCTGGG - Intergenic
1169155302 20:3324553-3324575 TTCTAGGGGCAGAGGGCCCTGGG - Intronic
1169194957 20:3677999-3678021 TCCAAGGGTCTCAGAGTCTTTGG + Intronic
1169589871 20:7128701-7128723 TCCCACTGGCTGAGTGTCCTAGG - Intergenic
1170614378 20:17937162-17937184 TCCAAGGAGCTGAGAGGCCCCGG + Intergenic
1170897969 20:20433414-20433436 TGCAAGGGGCTGAGGGGATTTGG + Intronic
1171389098 20:24789803-24789825 TCTCTGGGGCTGAGGCTCCTGGG - Intergenic
1172006375 20:31821503-31821525 TCCGTGGGGCTGTGGGTCATGGG - Exonic
1174425238 20:50427554-50427576 TGAAGGGGGATGAGGGTCCTTGG - Intergenic
1175997711 20:62818872-62818894 TTCCAGGGGTTGAGGGTCCTGGG + Intronic
1176055365 20:63142858-63142880 CCTAAGGCACTGAGGGTCCTGGG + Intergenic
1180799676 22:18625917-18625939 TGCGAGGGGCTGTGGGTGCTGGG + Intergenic
1180951274 22:19721685-19721707 GCCAAGGGGCAGCGGGTCCGGGG + Exonic
1181222040 22:21369349-21369371 TGCGAGGGGCTGTGGGTGCTGGG - Intergenic
1181458382 22:23071937-23071959 TGCACGGGGCTGAGGGAGCTGGG + Intronic
1183230281 22:36577895-36577917 TAGAAGGGGCTGAGAGCCCTGGG + Intronic
1183309486 22:37101685-37101707 TCCATGGGGCTGAGGACCCAAGG - Intronic
1184137976 22:42560606-42560628 TCCCAGGGGCTGAGTGACTTGGG + Intronic
1184834341 22:47012288-47012310 TCCATGAGTCAGAGGGTCCTGGG + Intronic
1185195714 22:49468058-49468080 TCGAAGGGACTGGGGGGCCTTGG + Intronic
951445655 3:22776971-22776993 TCCAAGGAGCTGATGGGCCACGG + Intergenic
951709776 3:25576184-25576206 TCCTAGGGGCTTTGGGTGCTGGG + Intronic
952962617 3:38602255-38602277 TCCATGAGGCTGAGGCTCCAGGG + Intronic
954841948 3:53519176-53519198 TGCTAGGGTTTGAGGGTCCTTGG + Intronic
956457463 3:69436963-69436985 TACAAGAGGCTGGGGGTACTGGG + Intronic
959693460 3:109224278-109224300 TGCAAGGGGCTGAGCGTGGTGGG - Intergenic
961438065 3:126932891-126932913 GCCGCTGGGCTGAGGGTCCTAGG + Intronic
963595320 3:147318133-147318155 TCTAAAGAACTGAGGGTCCTGGG - Intergenic
966312030 3:178604130-178604152 TCCAAAGGGGTGAGAGTACTGGG - Intronic
968610292 4:1554006-1554028 GCCAGGGGGCTGTGGGTCATGGG - Intergenic
968890938 4:3368110-3368132 TCCCAGGGTCTGGGGGCCCTGGG + Intronic
969043060 4:4316207-4316229 TCCCAGGTGCTGAGGGCTCTTGG + Intronic
970600269 4:17636579-17636601 GCCAATGAGCTGAAGGTCCTCGG + Exonic
972313688 4:37905336-37905358 TCTAAAGAACTGAGGGTCCTGGG + Intronic
973338233 4:48977602-48977624 TCTACGGAGCTGATGGTCCTTGG - Intergenic
973981972 4:56314914-56314936 TCCAGGGGGCCGATCGTCCTGGG + Exonic
974529960 4:63096067-63096089 TGCAAGTGGCTTAGAGTCCTAGG - Intergenic
974821676 4:67074370-67074392 AACAAGAGGCTGAGGGTCCTGGG + Intergenic
976124136 4:81815433-81815455 GCCAAGAGGCTGAGAGTCATGGG + Intronic
979706642 4:123727545-123727567 TCCAATGGACTTAGGGTACTTGG + Intergenic
980160408 4:129154909-129154931 TCCAAGGGACTGACGGCTCTGGG + Intergenic
981847381 4:149184962-149184984 GCCAGGGGGCTGAGTGTGCTAGG + Intergenic
982338577 4:154268986-154269008 TCCAGGTGTCTGAGGGTTCTGGG - Intronic
983230887 4:165127678-165127700 GCCAAAGGCCTGAGAGTCCTTGG - Intronic
983303554 4:165957673-165957695 TCCAATGGACTTAGGGTACTTGG - Intronic
984878654 4:184391263-184391285 TCCAAGGAGGTGAGGATCATGGG - Intronic
984943512 4:184953823-184953845 TCCAAGAGGCTGGGTGTCCCTGG - Intergenic
984967154 4:185149526-185149548 TCTCAGAGGCTGAGGGTTCTAGG - Exonic
985945011 5:3174759-3174781 CCTAAAGGACTGAGGGTCCTGGG - Intergenic
986233271 5:5885837-5885859 CACAAAGGGCTGAGGGCCCTGGG - Intergenic
987650164 5:20730952-20730974 TCCAAGGGGATGAGGTTAGTTGG - Intergenic
988307415 5:29510360-29510382 TCCATGTGGCTGCAGGTCCTAGG - Intergenic
988556912 5:32244937-32244959 TCTAAAGAACTGAGGGTCCTGGG + Intronic
988745395 5:34130515-34130537 TCCAAGGGGATGAGGTTAGTTGG + Intergenic
989141534 5:38206384-38206406 TCCTTGGGACTGAGAGTCCTTGG - Intergenic
990328999 5:54706954-54706976 CCCAAGTGGGTGAGGGGCCTGGG - Intergenic
992013608 5:72555023-72555045 ATCCAGGGGCTGAGGCTCCTTGG + Intergenic
992448014 5:76851141-76851163 TCCCAGGAGCTGAGGGGCATCGG + Intronic
995671570 5:114609867-114609889 TCCCAGGGGATGAGGGACCCTGG + Intergenic
996658227 5:125967194-125967216 TCCAAGAGGCTGAGAGCCCTAGG + Intergenic
997228516 5:132227331-132227353 TCCCAAGGGCTGGGAGTCCTAGG - Intronic
997583427 5:135031066-135031088 TCAAAGGGGTTGAAGGTCCGAGG + Intronic
998004716 5:138649339-138649361 TCCAGGAGGCTGAGGCTGCTGGG - Intronic
998141369 5:139701410-139701432 TCCAAGGCGCTAGGGGACCTTGG + Intergenic
999368908 5:151040921-151040943 TCCAAGGTCCTGATGGGCCTTGG + Intronic
999776189 5:154814590-154814612 ATCAAGGGGCTGATGCTCCTGGG - Exonic
1000006772 5:157192723-157192745 GCCAAGGGGCATAGGGTTCTGGG - Intronic
1000220222 5:159208422-159208444 TTCACGGGTCTGAGGGTCCTTGG + Intronic
1001114829 5:168930823-168930845 GCCAAGGGACTCAGTGTCCTGGG - Intronic
1001116644 5:168946233-168946255 TCCAAGGGCCTGAGAGACCAAGG + Intronic
1001596595 5:172902569-172902591 TCAGAGGGGCCGAGGGTGCTGGG + Intronic
1001648461 5:173298983-173299005 TCCAAGGGGCTGGGGGAGCAGGG - Intergenic
1001686240 5:173596982-173597004 TCCAAATGGCTGGGGGGCCTTGG + Intergenic
1001950815 5:175815231-175815253 TCCGATGGGCTGGGGGCCCTAGG + Intronic
1001997393 5:176173508-176173530 TCCAGAGGGCTGAGGGGCCCGGG + Intergenic
1002896446 6:1382910-1382932 TCCAAGGCGCTGAGAGCCCACGG - Intergenic
1004035673 6:11920668-11920690 TACCATGGGCTGAGTGTCCTGGG + Intergenic
1004874135 6:19938473-19938495 TCCCAGGTGCTGAGGGTCTCTGG + Intergenic
1005105898 6:22223786-22223808 TTCAAGGAGATGAGGGACCTTGG - Intergenic
1005543511 6:26838267-26838289 TCCAAGGGGATGAGGTTAGTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006375734 6:33670830-33670852 GCCCAGGGGCTGGGGGTCCGTGG + Intronic
1006450689 6:34104181-34104203 TCCAAGGGGCAGAGAGAGCTGGG + Intronic
1006576402 6:35049587-35049609 TCCAACTGGCAGGGGGTCCTAGG + Intronic
1006633098 6:35443368-35443390 TCCAGGGGGCTGGGGGTCTTTGG - Intergenic
1007130421 6:39467079-39467101 CCCAAGGAACTGAGGGTACTTGG + Intronic
1007588820 6:43009084-43009106 TCCTTGGGGCTGTGGGTCTTGGG - Exonic
1008370440 6:50724629-50724651 TCCAAGGAGCCGCGGGTCCCTGG - Intronic
1009014341 6:57880436-57880458 TCCAAGGGGATGAGGTTAGTTGG + Intergenic
1015524236 6:134160218-134160240 TCCAGGGGTCTGAGGGTACATGG + Intergenic
1016516371 6:144897006-144897028 TTCAAGGGGCTGAAAGTCCAAGG + Intergenic
1017344057 6:153358619-153358641 CCTAAGGAACTGAGGGTCCTGGG - Intergenic
1018160906 6:161041403-161041425 GCCTGTGGGCTGAGGGTCCTGGG - Intronic
1019998702 7:4742221-4742243 TGAAAGGGGCTCAGGGCCCTCGG + Intronic
1020845639 7:13278552-13278574 TATAAAGAGCTGAGGGTCCTGGG - Intergenic
1021987400 7:26110176-26110198 TCTAAAGAACTGAGGGTCCTGGG - Intergenic
1022132640 7:27418321-27418343 TTCAAGGAGCTTATGGTCCTGGG + Intergenic
1022502948 7:30893993-30894015 TCCAAGGGGCAGAGTTTTCTAGG + Intergenic
1026440138 7:70437243-70437265 TCCAAGGAGCTAAGGCTCCTGGG - Intronic
1027216896 7:76189577-76189599 TCCTTGGGGGTGAGGGTCCCTGG + Intergenic
1030008868 7:105145880-105145902 ACTAAAGGGCTGAGGCTCCTGGG - Intronic
1030561861 7:111097163-111097185 TCCAAAGGCCTGAAGCTCCTGGG + Intronic
1035000582 7:155609482-155609504 CCCAAGGGGCCGAGGGTGCAGGG - Intergenic
1036572884 8:9997410-9997432 TCCAAGCCCCTGGGGGTCCTGGG - Intergenic
1038718069 8:30009613-30009635 TCCCAAGGGCTGAGGTTCCTTGG + Intergenic
1039448494 8:37651438-37651460 CTCAAGGGTCTGATGGTCCTTGG - Intergenic
1040457987 8:47619499-47619521 TCCAAGGGGCAGAAGATCCAGGG - Intronic
1042187119 8:66147859-66147881 TCCAAGGTGCTCTGTGTCCTAGG + Intronic
1048954641 8:139525823-139525845 TCCAAGGCCCTGAGGTTGCTAGG + Intergenic
1049200624 8:141338617-141338639 CCCAAGGCCCTGAGTGTCCTAGG + Intergenic
1049508802 8:143017830-143017852 TCCGAGGGGCTGTGGGCGCTGGG - Intergenic
1049675716 8:143888022-143888044 TCCAAGGGGCCGCAGGGCCTTGG - Intergenic
1051213678 9:14773530-14773552 TCAAAGAGACTGAGGGTTCTGGG + Intronic
1053423792 9:37997916-37997938 GCTAAGGGGCAGAGGGCCCTGGG + Intronic
1055672951 9:78625450-78625472 TACAAGGTGCTGAGGGACCATGG + Intergenic
1056446374 9:86669998-86670020 GCCAGTGGGCTCAGGGTCCTGGG + Intergenic
1056816235 9:89803228-89803250 TCCAAGGGGATTAGGTCCCTGGG + Intergenic
1058963362 9:110013127-110013149 TGCAAGTGGATGAGAGTCCTGGG - Intronic
1059212978 9:112531909-112531931 TCCAAGAGCTTTAGGGTCCTCGG - Intronic
1060228224 9:121809017-121809039 TCCCAGGGGCTCAGGGCCCCAGG - Intergenic
1060973662 9:127753076-127753098 TCCAAGGGGCTGTGGGGGCAGGG + Intronic
1061218727 9:129236749-129236771 TCCTGGGGGCTAGGGGTCCTGGG + Intergenic
1061960398 9:133985615-133985637 TCCAAGGAGCTCTGGTTCCTTGG - Intronic
1062039342 9:134396915-134396937 TCCAAGGGCCGGAGGTTCCCTGG + Intronic
1062127090 9:134869744-134869766 TCCGAGGGGCTGAGGCTCACAGG + Intergenic
1186410251 X:9340431-9340453 ACCCAGGGGCTGAGGGGCCGGGG + Intergenic
1187019993 X:15370983-15371005 TCACTGGGGCTGATGGTCCTGGG + Intronic
1189335523 X:40168642-40168664 GCCAAGGGGCTGGGGCTCCCCGG + Intronic
1190331088 X:49235807-49235829 TGTAAGGGGGTGAGGGTCTTAGG - Intronic
1190332309 X:49243329-49243351 TCCAACAGGCTGAGGCACCTGGG - Exonic
1190746556 X:53326600-53326622 TCCCAGGGACTGAGGCTTCTGGG - Intergenic
1192003482 X:67182824-67182846 TCTAAAGAACTGAGGGTCCTGGG + Intergenic
1196094130 X:111780527-111780549 TACATGGGGCGGGGGGTCCTGGG - Intronic
1199347109 X:146754483-146754505 CCTAAGGGGCTGAGGGCCCAAGG + Intergenic
1200070561 X:153527046-153527068 GCCATGGGGCTGTGGGCCCTGGG - Intronic
1202258829 Y:22948341-22948363 TTCAAGGGGCTGAAGGTAGTCGG + Intergenic
1202411817 Y:24582099-24582121 TTCAAGGGGCTGAAGGTAGTCGG + Intergenic
1202458965 Y:25087973-25087995 TTCAAGGGGCTGAAGGTAGTCGG - Intergenic